Showing posts with label genetics. Show all posts
Showing posts with label genetics. Show all posts

Sunday, March 01, 2009

Evolutionary challenges to gene engeneering a better human

My friend Terry is a bioengineer, as well as a part time futurist. Much of what people in his field work on (as judged by what Terry talks about when he puts on his futurist hat and has a couple of glasses of wine) is thinking about how to modify the human genome to increase our lifespan and healthspan (I just made up the word healthspan, but I bet someone out there is already using it). Much of my work is to understand how and why we evolved to have the lifespan and healthspan we currently do. My understanding of my work is not promising to my understanding of this part of Terry's colleagues' work. In my view, bioengineering a much longer lived human will be extraordinarily difficult for several reasons.

First, we have a great many systems that seem to fail at about the same age, and there are good evolutionary reasons why this should be. Why bother building a femur that last longer than your heart, or your brain, or your pancreas? So to engineer a much longer-lived human, one has to be prepared to make a large number of changes to see a small effect. Terry counters that there will inevitably be some low-hanging fruit, and I concede this point. Simply by editing out some of the purely harmful mutations in the human gene-pool, we can probably extend average life span by a few months or maybe a couple of years. But because so many things fail at similar ages, no one or two or 100 changes could give us healthy 150 year olds.

Second, many individual genes have an enormous number of different effects in a wide range of systems, tissues and traits. When a gene has more than one effect, this is called pleiotropy, and we are chock full of pleiotropies, most of which we don't yet know about or understand. DNA is not like a blueprint, where you can just erase one wall, re-route a few wires, and draw in a new door. It is more like a vastly sprawling and disorganized system of interacting computer applications, add-ons, duplicates, and operating systems (only without any comprehensible order, annotation or easily understood compartmentalization). Something which functions as part of an unnecessary application may also be used in several disparate parts of the operating system. Modify a line of code and all sorts of unintended things can happen. Evolution has fine-tuned this system of interactions through millions of generations of trial and error, with emphasis on the error. Our best computer simulations are barely able to comprehend the folding of a single amino acid string into a protein, let alone a whole cell or organ or human, and animal models only go so far. So the process to modify evolution's optimization would not be fun, fast or clean. Our various bits are tuned to work together, and most potential single modifications can only move us away from that local optimum.

Terry counters that in many cases what evolution was tuning was utility in the form of health/strength/life vs. cost in the form of calories. A large part of the theory of life-history evolution is based on models where developing organisms have limited nutritional resources to invest in important tasks like growing, healing and reproducing. If one assumes unlimited calories are available, one can theoretically grow, reproduce and heal maximally all at the same time. And in Terry's view (which I can't help but see the wisdom in) anyone who can afford to play with the human genome can also afford plenty of potato chips. For the relevant population, calories are no longer limiting. In fact, we go out of our way to burn extra calories now. Spending calories lavishly to buy a few extra years of life or more garish secondary sexual traits is a win-win. The bioengineers of the future will have the advantage over evolution, because they won't have to worry about one of the main constraints evolution was dealing with, calorie restriction. So we may have to change a few things at once to make it all work well together, but we can do that. We can, in my imagining of Terry's thinking, reengineer the organism to its new environment.

It occurred to me last night that there is third, bigger and more insurmountable barrier to re-tuning. One that is not just a technological limitation: Breeding. Humans have been known to breed with each other, and in doing so they mix their genomes. You have half the genome of your biological father and half the genome of your biological mother. Imagine if your uber-mench father had a carefully altered suite of genes, and your mother was a good old-fashioned non-GMO woman. What do you get? You get half a carefully altered genome mixed with genes they were never designed to interact with. Chances are, you have all sorts of wacky health problems, and greatly reduced longevity. It would be like taking half the code of Mac OS 9 and half the code of OS X and expecting a stable operating system.

This means that every change and group of changes would have to be carefully designed to be back-compatible. The alternatives are gene altering the entire human population (which would never ever ever ever work (and I very rarely use that many "ever"s in a row)) or engineering the longevous new humans to be incapable of interbreeding with the old model. They'd have to start by separating off one population as a seperate species, Homo terrii, and only thereafter get serious about reengineering.

So suppose the engineers decide they want to make everything back compatible?
I'm not convinced this would work either. Most mutations are bad for you not only because they break a piece of the system, but because they make a new piece that doesn't work with what is already there. Requiring back compatibility means we have to have every piece work with not only the old set of genes and the new set of genes, but every possible combination of old and new. Evolution, largely free from constraints of time, funding and ethics, accomplishes this by letting those individuals who have bad combinations die out until there are very few harmful combinations possible. To extend the computer code analogy, this would be like trying to write OS XI in such a way that if one blended the code with OS X, it would still work. It is possible to do, but XI would end up looking an awful lot like X, too similar to be more than a service update.

This leaves only the option of creating a population incapable of breeding with normal humans and altering their genes extensively to try to overcome a large number of age-limiting factors at once. Again my understanding of evolution suggests a major difficulty. To do this successfully, one would need a large population all gene-altered simultaneously, to avoid inbreeding effects. One can't start a new population with just a few individuals and expect that species to have a decent chance of surviving well. Even if the species does make it through, there is likely to be an extended period of decreased lifespan and healthspan while the inbreeding kinks work themselves out and the population increases in size and genetic diversity.

Without doubting that bioengineers will continue to make things that seem impossible become projects of undergraduates, I consider it highly unlikely they will achieve any very significant advances in human longevity in the next few decades.

(NOTE: I sent this to Terry for comment or objection some time ago but he has been busy with 'job' and 'editing the book.' I take his failure to offer a substantive reply as evidence that in some basement deep under campus, his department is already failing to build an immortal human.)

Wednesday, November 26, 2008

Binning Algorithms for Metagenomic Sequencing

One of my assistants, SM, who is at least as smart as me and twice as hard working, wrote to ask my advice.

SM: Do you know of any good binning algorithms for metagenomic sequencing?
DL: Huh? What does, "binning algorithms for metagenomic sequencing," mean?

SM has not given me an answer. Either she assumes I am joking, and actually do know (which I don't) or she assumes it would take far too long to explain it to me (which I will pretend to resent.) So now I shall try to reckon out what "binning algorithms for metagenomic sequencing" means on my own.

Metagenomics, according to my sources (Wikipedia) "is the study of genetic material recovered directly from environmental samples." So, you take a pinch of garden dirt, extract all the DNA in it and then set out to study it in some way. You are metagenomisizing.

Sequencing, in the context of genetics, means figuring out the sequence of DNA bases (A's, T's, G's and C's) that make up part of the genome of an organism. So metagenomic sequencing presumably is taking the DNA from your pinch of dirt, then trying to figure out the sequence of DNA bases that made up all the genomes of all the organisms whose DNA are jumbled together in that dirt. A pinch of dirt, I am guessing, has DNA from hundreds of types of bacteria, a huge number of types of fungi, various protozoans and whatever else has dropped seeds, pollen, poo, tissue or hair in that vicinity in the recent past. And much of that DNA isn't going to be whole chromosomes, but whatever bits and pieces are still mostly intact after all that pooing and shedding and biodegrading. You'll have a real mishmash.

This, I suspect, is where the "binning algorithm" comes in. Binning is any process where you have a large number of elements and you want to separate them into a smaller number of categories. A binning algorithm would be a set of rules one uses to make those decisions on categorization. In the context of metagenomics, I'm guessing that each bin represents a species. You have a snippet of DNA and you need to assign it to an organism, so you don't just think that every bit of DNA is another organism, and you want to get a sense of how much representation you have of each species. So the set of rules you use to assign snippets of DNA extracted from your pinch of dirt to different species is your Binning Algorithms for Metagenomic Sequencing. I think.
My friend DS works on this kind of stuff. I'll write to him and ask.

UPDATE:
I wrote to SM and DS and asked:
Will one of you tell me what "binning algorithms for metagenomic sequencing" means?
I know what each word means, but I could come up with three or four very different guesses as to what the whole phrase means. What does each bin represent?

DS writes: [Bins represent] Taxa. In metagenomic sequencing, you get a soup of reads from all the strains of microbes present in your sample. "Binning" is the process of trying to guess which species each read comes from (or genus, or kingdom for that matter).

All methods in the literature so far are "supervised", meaning that you can only assign a read to a taxon bin if you know something about that taxon in advance (e.g., you have an isolate genome). However, environmental samples may contain previously unknown taxa: new bacterial divisions are still being discovered fairly rapidly, and at the strain level of course nearly everything is novel. A supervised binning process ought to throw up its hands at sequences from novel taxa, since they don't match any known bins. An "unsupervised" process would create new bins on the fly, in order to lump together reads that seem to be related to each other, independent of reference sequences. No published methods do that yet, though.

The accuracy of binning varies dramatically depending on the complexity of the community, the read length, the phylogenetic resolution you're asking for, and many other parameters.

Hope this helps,

-ds

Saturday, November 22, 2008

Reader JTE asks:

Q:What does

two individuals with the same genotypes, except for those genes determining sex (which is some species don't exist, where sex is environmentally determined),

mean?

A: I'm glad you asked.

It means that if I had one missing or dysfunctional gene on my Y chromosome (or was XX instead of XY), I would be phenotypically female, but the rest of my genome would be the same as it is now. A great many aspect of my physical, chemical, social and mental being (my phenotype) have been altered by the effects of this one gene, which acts as a sex switch. Switch on maleness, and a whole bunch of aspects of phenotype are altered. Don't switch it on, and you get a different phenotype.

In some species, there are no X and Y chromosomes, or anything equivalent, to act as a sex switch. Instead, whether an individual develops as a male or a female is determined by the environmental conditions which prevail at a certain point in development. In alligators for example, there is no genetic determination of sex. Instead, if the temperature around the egg is above a certain temperature at a certain point in development, the alligator becomes one sex (I think male, but I don't actually remember). If it is ?colder? than that temperature, you get a female alligator. Many of the aspects of the switch are the same, only the first step of the switch is very different.

So my colleague was pondering the fact that two individuals with similar, or even identical, genotypes can have importantly different phenotypes, based on the action of this switch. This means that whether this switch is on or off can greatly affect the actions of other genes, and therefore the effects those other genes have on the survival and reproductive success of the organism.

Thursday, November 20, 2008

Intersexual Correlation

A colleague wrote to ask me what I thought about an idea he'd had. He was thinking about the fact that one could have two individuals with the same genotypes, except for those genes determining sex (which is some species don't exist, where sex is environmentally determined), and end up with significantly different phenotypes. In some traits (e.g. Hair color) these two individuals would be expected to have very similar traits, in others (e.g. genital morphology) they would be expected to be very different, and perhaps in some cases uncorrelated or negatively correlated. He wondered if this might affect the ability of individuals to choose mates who would produce highly successful offspring. For instance, a female sizing up a male would have a better sense of what that male's sons would look like than what his daughters would look like. A big very masculine male might tend to have oversized and somewhat unattractive daughters. My colleage wondered if this might confuse things enough to slow down the action of sexual selection, and allow a greater genetic diversity to remain in the population than would otherwise be the case. I found htis a very interesting question, and wrote the following reply:

There is a body of literature on the degree to which natural selection on the traits of one sex will affect the traits of the other sex. People often use the term "correlated evolution" to describe this sort of thing. When there is a correlation (positive or negative) in a trait between the female expressed genotype and the male expressed genotype, I've seen the phrase "intersexual correlation." I am not terribly familiar with this literature, I'm afraid.

This recent paper is the closest thing I know of to what you are talking about.

Whether any of this would lead to a greater genetic diversity in the population, I am not sure. The effects of natural selection may be somewhat weaker, as traits that are expressed in one sex but not the other are less often expressed, and therefore less often subject to selection (an epistatic interaction in effect). In the case of sexual selection, my guess would be that as long as degrees of intersexual correlation in particular traits evolve more slowly than do what cues individuals use to choose mates, choosers should evolve to focus on characteristics that are good indicators of fitness in both male and female offspring. I think this will generally be the case, as there is clearly very strong selection against those who use misleading cues in mate choice. I am not aware of any reason to think there would be rapid change in the degree of intersexual correlation in a wide range of traits all at once. As long as there is any consistently reliable signal available, the family lines that use it should tend to do better than the population average.

It raises an interesting set of questions, I am not sure how many of them there is any literature on.

Does this answer your question? If you want more expert answers we could ask Monty Slatkin, who I am sure has thought about this in some detail at some point.

Tuesday, January 15, 2008

Numeric encoding in DNA

Stephen-
That is another question that is somewhat outside my area of knowledge, but I can tell you what I know. Number can be encoded in DNA in several ways. The most basic is that different individuals can have different numbers of copies of the same gene. Our chromosomes have lots of stretches of DNA that have been duplicated, sometimes many times. Something in the DNA replication process screws up, and you end up repeating a section of the chromosome, like a record skipping while you are making a copy of it. So if I have 2 copies of a gene, and you have 12, that is numeric information. Similar, but not necessarily to the point, are tandem repeats such as microsatellites. This is basically a stutter in (usually non-coding) DNA. A section of chromosome might have ATCATCATCATCATCATCATCATC so that is eight repeats. The other chromosome in the same person could have twelve repeats, and someone else could have 23. These things seem to combine a high mutation rate with very little selective pressure, meaning that they can evolve relatively randomly and very quickly, meaning they are very diverse within a population. For that reason they are often used for genealogical reconstructions and such.

Not exactly numeric, but not binary, is gene expression modulation. Genes are not necessarily just "on" or "off." A wide range of factors can turn up or down the expression a particular gene, including the particulars of the interactions of non-coding DNA in the promoter region at the beginning of that gene with the various promoter or repressers , which can themselves vary in concentration and structure. So the production from a gene is not 0 or 1 but rather can vary continuously from 0 to 1.

On the subject of telomeres, what their length determines is the number of times a cell can divide before its line dies out. This does not so much encode longevity, as take a part in determining the tradeoff between ability to heal and cancer risk. The body has many mechanisms that limit the ability of cells to divide rapidly, which reduces the risk of cancers (which are defined in part by their unchecked cell division)
but also limits healing (which requires cell division). Telomeres are one such mechanism. It is important to keep in mind though that there are enzymes that can extend telomeres, even in adult organisms, and most organisms have telomeres that are much longer than is needed for most of their cell lines to continue dividing throughout their lifetimes, and therefore telomeres are not in any meaningful sense coding for longevity.

I am sure there are other mechanisms of numeric encoding in genetic material, but I don't know what they are.

In response to your question about averaging of parental values, I would say this generally does not happen. For highly heritable traits, the mean value of the offspring should be similar to the mean value of the parents, but it is not the case that every individual offspring will be at or near that mean value. This is a point that is actually extremely important. During Darwin's time, there was a Scottish biologist whose name I can't remember now, who showed mathematically that if offspring get the mean value of their parents, Darwinian evolution does not work very well (effectively because variation is constantly being eliminated). Darwin was stumped for at least a while, until it was pointed out that each offspring does not get that mean value, but rather some value in a range centered on that mean. As an example, my brother is taller than either of my parents (even adjusting for sex) I am about the same height as my parents (again adjusting for sex) and my sister is (again adjusting) shorter than either of my parents.

So I am curious why you are asking all these questions about quantitative genetics. I assume you have had some idea for which genetics is a good analogy?

-Dan

Monday, January 14, 2008

Genetic Answer for Stephen: How and why traits vary continuously

Stephen-

There are several factors that can contribute to continuously varying traits, and we have to be careful not to conflate them. They are often divided into two broad categories, genetic factors and environmental factors, although there are often non-linear interactions between these.
On the genetic side, traits come in several flavors. The two state trait, where either you have it or you don't, is the classical Mendelian trait. Peas in a particualr population are white or green. If you have two alleles for green, or one for green and one for white, you make green peas. If you have no alleles that code for the green pigment, you make white peas. Next, as you described, are the three state genetic traits. Still all coded for at one locus, but dosage dependent, you end up with 0 or .5 or 1 full dose of the gene product. This is called incomplete dominance.
Then you get into additive multi-gene traits. Many different genetic loci have can affect human height, as an example. There was one gene, who's name I don't remember, that was recently shown to exhibit incomplete dominance in affecting human height. AA individuals are on average 5mm taller than the background population, Aa individuals are, on average, no different from the background population, and aa individuals are on average 5mm shorter than the mean of the population. But obviously height in humans varies by more than 1cm, so their must be other factors contributing. Some of these factors are genes affecting the length or shape of individual bones. Of those, some are classically dominant, some are incompletely dominant, and some may even be overdominant (where the Bb individual would have a longer bone than the BB or the bb). When you add together the variation in all these genes, you have a huge range of possible combinations, and end up with data that look pretty continuous. But then it gets even more complicated.

Genetic effects are not always additive. Imagine one gene codes for the presence a knob on a bone, and another gene causes that knob to be long or short. If an individual has the allele that causes that knob not to exist, it doesn't matter whether or not it has the allele that would make that knob long. If the knob isn't there, it can't be long. This is called epistasis. The sole effect of many genes, on a molecular level, is to regulate the activity of other genes. One gene makes a protein that carves up the protein product of a second gene, preventing that second protein from binding to a particular point on a chromosome where it would keep a third gene from being transcribed. Raise the temperature slightly, and the first protein changes conformation, and lets the second protein be, which cuts off production of the thrid gene. But if the Sodium concentration in the cell is too high, the third gene will be turned off anyway, because the excess sodium prevents the change in conformation of the first protein. People have mapped out enourmous cascades of gene effects with many branches, feedback loops, multiple environmental and epigentic modifiers and so forth. Just about every gene is pleiotropic, meaning that is has more than one effect. Similarly, almost every gene has multiple things that determine when, where, and how strongly it is expressed. Genes can also have synergistic interactions, competitive interactions, and so on.

So the genetics allow for a large number of possibilities, meaning that even purely genetic traits can vary close to continuously. But very few traits are purely genetic. Human height certainly isn't. The nutritional state of your mother before and during her pregnancy has an effect on your height. So does your own nutrition during the time you are growing. My grandfathers, who were cold and hungry through much of their childhoods, were shorter than any of their male grandchildren. My grandmothers, similarly, were shorter than any of their granddaughters. We, and our parents, ate better, so we grew more. Most Americans are taller than their grandparents were, not because of any genetic change, but because our environment is different than theirs was.

Once again, there are non-linear interactions, both between environmental effects, and between environment and genes. In some cases organisms seem to be genetically programmed to let the environment have a very strong effect on their development. I won't go into detail because I think you get the picture. We are vastly complex systems, and their is ample opportunity for feedback, interference, competition and so forth. And given the number of inputs, and the complexity of the algorithm, continuous outputs are nearly inevitable. Even classical Mendelian traits are rarely all that discrete in their distribution if one allows environment to vary and does not have an inbred population.

As for growth thresholds, what tells a bone to stop getting longer now, and start growing internally instead, I know very little. The molecular basis of development is a very active field of research, but is far enough from my own that I haven't paid much attention to it.

Have I answered your question?

-Dan

Sunday, January 13, 2008

Genetic Question for Dan

What is the genetic mechanism that controls continuously variable traits (height, bone thickness, pigmentation, etc.) ? I am aware the very simple case in flowers where the presence of normal petal color is determined by two copies of a gene, each of which produce a certain enzyme. A flower can have either zero, one or two copies of this gene, which results in a net production of the pigment enzyme in corresponding amounts of zero, about half-normal, or full-normal. The resulting flower color is then either pure white when there is no enzyme, whiteish-purple for medium enzyme levels, or deep purple when enzyme levels are fully normal. In principle, this is really a three-state set of trait values {0, 1/2, 1}. Although it is possible that environmental factors might cause the ½ level of enzyme to vary between individual flowers, resulting in a smearing out of the medium state in color space, such that the distribution of trait values appears to be a bit more continuous in the population

Is multi-gene encoding of enzyme/hormone levels the only way that continuously variable traits are controlled? What about genes being turned on and off? A single gene turns on and starts producing a certain growth hormone. The creature keeps growing until a certain condition is met, at which point the gene turns off, the hormone levels dwindle, and the creature’s shoe size has reached its maximum value. However, although only one gene encoded the recipe for the growth hormone, there must have been something else that prescribed the “turn off” condition, and that would be what is really responsible for the creature’s terminal value of shoe size. Different individuals with different shoe sizes would have identical growth hormone genes, but would have variation in the genes that encoded their shoe size via this “stop making hormone, my feet are big enough” mechanism. Unfortunately, we are right back to the fundamental question of how is a continuous numeric quantity is encoded by a set of genes. In this example, we would need to understand how the “hormone turn off” mechanism worked, and what knob in this mechanism could be continuously controlled via variation in some set of genes.

When you think about it, just about every little detail in an organism must have some sort of a control like this, since the length, curvature, and density of bones, muscles, organs, are all continuously variable during the growth of the organism. The final shape of each piece must be determined by possibly hundreds of specific dimensions and continuous quantities. How much is currently known about the mechanisms for encoding this information in our genome? If there are any serious flaws in my reasoning, or biological basics, please let me know, as I am very curious to understand this better.

Thanks

- Stephen

Thursday, September 27, 2007

Germ-line chimerism and paternal care in marmosets (Callithrix kuhlii)

Reference:
Ross, C., J. French, and G. Ortí. 2007. Germ Line Chimerism and Paternal Care in Marmosets (Callithrix kuhlii). Proc. Natl. Acad. Sci. USA, 104 (15): 6278–6282.


Abstract:
The formation of viable genetic chimeras in mammals through the transfer of cells between siblings in utero is rare. Using microsatellite DNA markers, we show here that chimerism in marmoset (Callithrix kuhlii) twins is not limited to blood-derived hematopoietic tissues as was previously described. All somatic tissue types sampled were found to be chimeric. Notably, chimerism was demonstrated to be present in germ-line tissues, an event never before documented as naturally occurring in a primate. In fact, we found that chimeric marmosets often transmit sibling alleles acquired in utero to their own offspring. Thus, an individual that contributes gametes to an offspring is not necessarily the genetic parent of that offspring. The presence of somatic and germ-line chimerism may have influenced the evolution of the extensive paternal and alloparental care system of this taxon. Although the exact mechanisms of sociobiological change associated with chimerism have not been fully explored, we show here that chimerism alters relatedness between twins and may alter the perceived relatedness between family members, thus influencing the allocation of parental care. Consistent with this prediction, we found a significant correlation between paternal care effort and the presence of epithelial chimerism, with males carrying chimeric infants more often than nonchimeric infants. Therefore, we propose that the presence of placental chorionic fusion and the exchange of cell lines between embryos may represent a unique adaptation affecting the evolution of cooperative care in this group of primates.

Translation: According to the seminar I went to today, what this all means is that Marmosets and their relatives almost always produce fraternal twins, and the embryos grow in close proximity, with out the usual membranes separating them. The two developing embryos can actually have blood vessels in common, meaning that blood born cells can move from one embryo to the other. And stay there. And develop. So when the little monkeys are born and grow up, they can be riddled with cells that are genetically part of their sibling. This is what we call a chimera, when one individual has cells that are of different genetic lineages.
So then one of the chimeric monkeys mates. But some of his germ line cells (the ones that make sperm) are genetically his brother. So he's doing the mating, but the young could be genetically his nephews. Weird, I know. And one outcome of all this is that marmosets put a lot more energy into taking care of their nieces and nephews than would otherwise be expected. Ain't evolution weird and wonderful.

Cartoon explanation: