I spent yesterday evening reading the literature on the extent to which there is phylogenetic inertia (the tendency for related species to have similar traits because they both inherited those traits from the common ancestral population) in cooperative breeding (the habit of having more than two individuals caring for the young).
My general conclusions are:
1. A species whose relatives are cooperative breeders are often cooperative breeders themselves.
2. It is not entirely clear if cooperative breeding itself is phylogenetically conserved in many groups, or if the traits that make it a useful strategy are conserved, leading to the impression of inertia in the evolution of cooperative breeding.
3. Phylogenetists spend a lot of time and ink poodling on about the flaws in each other's methods, but always end by saying that the conclusion about the trait is probably robust to minor variations in the shape of the tree.
4. Cooperative breeding is a blanket term for several different phenomena, and papers that deal with this explicitly are more convincing than those that only pay it lipservice.
5. The data I am already putting together on who provides how much care in 120 primate species could probably also be used for a very useful paper on phylogenetic inertia in cooperative breeding.
Friday, February 29, 2008
Monday, February 25, 2008
Biofuels won't fix it.
Pretty much every issue of Trends in Ecology and Evolution has a paper or two worth the reading. I thought this one was worth drawing your attention to:
Christopher B. Field, J. Elliott Campbell and David B. Lobell. 2008. Biomass energy: the scale of the potential resource. Trends in Ecology & Evolution. Volume 23, Issue 2, Pages 65-72
Abstract:
Increased production of biomass for energy has the potential to offset substantial use of fossil fuels, but it also has the potential to threaten conservation areas, pollute water resources and decrease food security. The net effect of biomass energy agriculture on climate could be either cooling or warming, depending on the crop, the technology for converting biomass into useable energy, and the difference in carbon stocks and reflectance of solar radiation between the biomass crop and the pre-existing vegetation. The area with the greatest potential for yielding biomass energy that reduces net warming and avoids competition with food production is land that was previously used for agriculture or pasture but that has been abandoned and not converted to forest or urban areas. At the global scale, potential above-ground plant growth on these abandoned lands has an energy content representing ~5% of world primary energy consumption in 2006. The global potential for biomass energy production is large in absolute terms, but it is not enough to replace more than a few percent of current fossil fuel usage. Increasing biomass energy production beyond this level would probably reduce food security and exacerbate forcing of climate change.
Christopher B. Field, J. Elliott Campbell and David B. Lobell. 2008. Biomass energy: the scale of the potential resource. Trends in Ecology & Evolution. Volume 23, Issue 2, Pages 65-72
Abstract:
Increased production of biomass for energy has the potential to offset substantial use of fossil fuels, but it also has the potential to threaten conservation areas, pollute water resources and decrease food security. The net effect of biomass energy agriculture on climate could be either cooling or warming, depending on the crop, the technology for converting biomass into useable energy, and the difference in carbon stocks and reflectance of solar radiation between the biomass crop and the pre-existing vegetation. The area with the greatest potential for yielding biomass energy that reduces net warming and avoids competition with food production is land that was previously used for agriculture or pasture but that has been abandoned and not converted to forest or urban areas. At the global scale, potential above-ground plant growth on these abandoned lands has an energy content representing ~5% of world primary energy consumption in 2006. The global potential for biomass energy production is large in absolute terms, but it is not enough to replace more than a few percent of current fossil fuel usage. Increasing biomass energy production beyond this level would probably reduce food security and exacerbate forcing of climate change.
Key Words
agriculture,
alternative power,
Climatology,
ecology
Sunday, February 24, 2008
Global Amphibian Declines call for frog costumes.
There are few, if any, taxa losing species diversity as quickly and thoroughly as the amphibians.
From amphibiaweb.org:
"Amphibians, a unique group of vertebrates containing over 6,200 known species, are threatened worldwide. A recent assessment of the entire group (globalamphibians.org) found that nearly one-third (32%) of the world’s amphibian species are threatened, representing 1,856 species. Amphibians have existed on earth for over 300 million years, yet in just the last two decades there have been an alarming number of extinctions, nearly 168 species are believed to have gone extinct and at least 2,469 (43%) more have populations that are declining. This indicates that the number of extinct and threatened species will probably continue to rise (Stuart et al. 2004)."
And this is almost surely an overly optimistic view. The thousands of species for which we have no data are not considered threatened, and an unknown number of others, likely in the hundreds, has gone extinct without ever being discovered.
Amphibian lineages that have existed for tens of millions of years are ending shockingly quickly. The factors that are killing off these ancient groups are all the works of humanity: pesticides, industrial pollutants, introduced species and diseases, habitat destruction and alteration and rapid climate change. There is no reasonable doubt but that we have driven the rate of amphibian extinction to several thousand times its natural rate. We could barely kill them off more quickly if we tried. Genocide is not too strong a term.
Amphibians are widely seen as indicator species. Healthy ecosystems have healthy amphibians. Indications are poor.
So to help raise (the currently abysmally low) awareness of the scope of amphibian declines, Iris and I have decided to walk Bay to Breakers wearing homemade from costumes. And we hope to organize a group of friends and colleagues to walk with us, similarly garbed. A costume recognizable as an amphibian, or even a shirt with amphibian pictures on it. Perhaps we will hand out informational pamphlets to people who ask what we are about. If you are interested in joining us, please email me.
From amphibiaweb.org:
"Amphibians, a unique group of vertebrates containing over 6,200 known species, are threatened worldwide. A recent assessment of the entire group (globalamphibians.org) found that nearly one-third (32%) of the world’s amphibian species are threatened, representing 1,856 species. Amphibians have existed on earth for over 300 million years, yet in just the last two decades there have been an alarming number of extinctions, nearly 168 species are believed to have gone extinct and at least 2,469 (43%) more have populations that are declining. This indicates that the number of extinct and threatened species will probably continue to rise (Stuart et al. 2004)."
And this is almost surely an overly optimistic view. The thousands of species for which we have no data are not considered threatened, and an unknown number of others, likely in the hundreds, has gone extinct without ever being discovered.
Amphibian lineages that have existed for tens of millions of years are ending shockingly quickly. The factors that are killing off these ancient groups are all the works of humanity: pesticides, industrial pollutants, introduced species and diseases, habitat destruction and alteration and rapid climate change. There is no reasonable doubt but that we have driven the rate of amphibian extinction to several thousand times its natural rate. We could barely kill them off more quickly if we tried. Genocide is not too strong a term.
Amphibians are widely seen as indicator species. Healthy ecosystems have healthy amphibians. Indications are poor.
So to help raise (the currently abysmally low) awareness of the scope of amphibian declines, Iris and I have decided to walk Bay to Breakers wearing homemade from costumes. And we hope to organize a group of friends and colleagues to walk with us, similarly garbed. A costume recognizable as an amphibian, or even a shirt with amphibian pictures on it. Perhaps we will hand out informational pamphlets to people who ask what we are about. If you are interested in joining us, please email me.
Sloppy
I've written here before about what a poor job journalists generally do in describing science to the public. I was just reading this Op-Ed piece in the NYTimes and wincing over phrases such as "sharks are very primitive living fish" and "ensure the survival of a species," which reveal a very out of date and human-centric misunderstanding of evolution. The piece includes at least half a dozen points contradictory to modern evolutionary theory. I was just considering writing yet another response letter explaining to the author that natural selection does not favor traits because they help ensure the survival of the species, and so forth, when I looked at who the author is.
The attribution:
"Neil Shubin, an associate dean at the University of Chicago and the provost of the Field Museum, is the author of 'Your Inner Fish: A Journey Into the 3.5-Billion-Year History of the Human Body.'"
Neil Shubin knows that evolution doesn't work that way. So why is he writing like a journalist? I can only guess it is because he wants to sell more books, and someone (the NYTimes, his publicist or him) felt that one has to adopt the public's misunderstanding in order to interest them. It is sad when scientists start writing like science journalists.
The attribution:
"Neil Shubin, an associate dean at the University of Chicago and the provost of the Field Museum, is the author of 'Your Inner Fish: A Journey Into the 3.5-Billion-Year History of the Human Body.'"
Neil Shubin knows that evolution doesn't work that way. So why is he writing like a journalist? I can only guess it is because he wants to sell more books, and someone (the NYTimes, his publicist or him) felt that one has to adopt the public's misunderstanding in order to interest them. It is sad when scientists start writing like science journalists.
Key Words
biases,
ecological illiteracy,
evolution,
fish,
science journalism
Saturday, February 23, 2008
Field Notes
FEB. 23 2008
D. Levitis
Hillside Natural Area (North Unit) El Cerrito, Contra Costa County, CA
Sijie Mao, Nichole Winters and I went out from 1300 to 1530. It was quite windy with very strong gusts, temp in the lower 50s and varying between slight drizzle and significant rain. Our fist stop was the detritus field around the storm drain at the lowest point in the park, just behind my house, under the Eucalyptus. A lot of good cover items, but nothing under there. From there we went just up the hill to the small pile of shipping pallets on the grass. Under the first one I lifted was an Aneides lugubris (Arboreal Salamander)! The first I'd seen here. We took this as a sign of good salamandering to come.
We followed a route approximated by that marked on this map, but with many side excursions to check under log, rocks and other cover objects:

Much of this part of the Nature Area has many of the cover objects removed for yearly mowing, so much of the available cover is in piles of cut log pieces or small rocks piled at the base of trees and in gullies.
Sijie and Nichole are extremely contentious about putting every cover item back exactly as it was, and are energetic and enthusiastic herpers. We found almost nothing under rocks, but the logs were very productive today. We checked under approximately 400 wood bits and 100 rocks/cement bits and found 71 Batrachoseps attenuatus (California Slender Salamanders) 3 Aneides and one Elgaria multicarinata (Southern Alligator Lizard).
The Aneides were all near oaks, as Dave Wake told me to expect, while the Batrachoseps were under logs and a few rocks in every habitat we checked. The Elgaria was under a pine log in grassy habitat.
In addition to the herps, invertebrates were extremely numerous under cover objects, including Jerusalem crickets, cave crickets, ants, termites, ground beetles, several kinds of spiders including a couple of Black Widows, copious pill-bugs, snails, slugs, worms and sundry.
Many fresh gopher diggings were evident in the soft wet earth, and many of the logs and rocks we lifted had smaller rodent tunnels, quite possibly vole. Deer prints and fox scat were in abundance.
One bird species to add to my list for the nature area, Wild Turkey. One was seen at the northwest corner of our route, just north of Snowdon Ave. and another was heard responding to its calls. Nichole took pictures of the turkey, which was tame enough to allow her to approach to within 6 meters.
Our explorations revealed no standing water in which frogs could breed, which may explain their absence from our observations.
Birding today wasn't great, due to wind and rain, but saw/heard following birds today:
Western Scrub-Jay (2)
American Crow (10)
Northern Raven (2)
Black Phoebe (1)
Yellow-rumped Warbler (25)
Chestnut-backed Chickadee (4)
House Sparrow (15)
Ruby-Crowned Kinglet (2)
American Robin (40)
California Towhee (3)
Dark-eyed Junco (4)
Wild Turkey (2)
Red-shouldered Hawk (1)
Anna's Hummingbird (3)
Mourning Dove (6)
Mammals:
Eastern Fox Squirrel (Sciurus niger) (2)
Mule Dear (Odocoileus hemionus) (tracks)
Voles (Microtus californicus? runways and burrows)
Pocket Gophers (burrows)
Fox (Grey fox? scat)
Herps:
Southern Alligator Lizard (Elgaria multicarinata) (1)
California Slender Salamander (Batrachoseps attenuatus) (71)
Arboreal Salamander (Aneides lugubris) (3)
D. Levitis
Hillside Natural Area (North Unit) El Cerrito, Contra Costa County, CA
Sijie Mao, Nichole Winters and I went out from 1300 to 1530. It was quite windy with very strong gusts, temp in the lower 50s and varying between slight drizzle and significant rain. Our fist stop was the detritus field around the storm drain at the lowest point in the park, just behind my house, under the Eucalyptus. A lot of good cover items, but nothing under there. From there we went just up the hill to the small pile of shipping pallets on the grass. Under the first one I lifted was an Aneides lugubris (Arboreal Salamander)! The first I'd seen here. We took this as a sign of good salamandering to come.
We followed a route approximated by that marked on this map, but with many side excursions to check under log, rocks and other cover objects:

Much of this part of the Nature Area has many of the cover objects removed for yearly mowing, so much of the available cover is in piles of cut log pieces or small rocks piled at the base of trees and in gullies.
Sijie and Nichole are extremely contentious about putting every cover item back exactly as it was, and are energetic and enthusiastic herpers. We found almost nothing under rocks, but the logs were very productive today. We checked under approximately 400 wood bits and 100 rocks/cement bits and found 71 Batrachoseps attenuatus (California Slender Salamanders) 3 Aneides and one Elgaria multicarinata (Southern Alligator Lizard).
The Aneides were all near oaks, as Dave Wake told me to expect, while the Batrachoseps were under logs and a few rocks in every habitat we checked. The Elgaria was under a pine log in grassy habitat.
In addition to the herps, invertebrates were extremely numerous under cover objects, including Jerusalem crickets, cave crickets, ants, termites, ground beetles, several kinds of spiders including a couple of Black Widows, copious pill-bugs, snails, slugs, worms and sundry.
Many fresh gopher diggings were evident in the soft wet earth, and many of the logs and rocks we lifted had smaller rodent tunnels, quite possibly vole. Deer prints and fox scat were in abundance.
One bird species to add to my list for the nature area, Wild Turkey. One was seen at the northwest corner of our route, just north of Snowdon Ave. and another was heard responding to its calls. Nichole took pictures of the turkey, which was tame enough to allow her to approach to within 6 meters.
Our explorations revealed no standing water in which frogs could breed, which may explain their absence from our observations.
Birding today wasn't great, due to wind and rain, but saw/heard following birds today:
Western Scrub-Jay (2)
American Crow (10)
Northern Raven (2)
Black Phoebe (1)
Yellow-rumped Warbler (25)
Chestnut-backed Chickadee (4)
House Sparrow (15)
Ruby-Crowned Kinglet (2)
American Robin (40)
California Towhee (3)
Dark-eyed Junco (4)
Wild Turkey (2)
Red-shouldered Hawk (1)
Anna's Hummingbird (3)
Mourning Dove (6)
Mammals:
Eastern Fox Squirrel (Sciurus niger) (2)
Mule Dear (Odocoileus hemionus) (tracks)
Voles (Microtus californicus? runways and burrows)
Pocket Gophers (burrows)
Fox (Grey fox? scat)
Herps:
Southern Alligator Lizard (Elgaria multicarinata) (1)
California Slender Salamander (Batrachoseps attenuatus) (71)
Arboreal Salamander (Aneides lugubris) (3)
Key Words
amphibians,
birds,
El Cerrito Hillside Natural Area,
Natural History,
reptiles
Thursday, February 21, 2008
"Science" "Journalism"
Even taking into account how poor the state of science journalism is in this country, and what a sorry rag the San Fransisco Chronicle is, this piece on the danger posed to San Francisco by invasive pythons is well below the curve.
To summarize, there is an introduced population of Burmese pythons in the Everglades, 3100 miles away. A USGS lab used an off the shelf climate model to predict where in the US Burmese Pythons could deal with the climate, and San Francisco (along with pretty much the southern half of the US) showed up as one potential habitat.
The idiot who wrote the article then follows this train of thought to show that pythons will be eating pedestrians on Market Street by 2020:
•One python showed up at Lake Okeechobee, 100 miles north of the Everglades, and in the same direction it would travel if its single-minded goal was to reach Fisherman's Wharf.
•Pythons can travel up to 20 miles a month, and the road to SF is 3000 miles, so it will be here in 150 months, or about 12 years.
•Pythons eat mammals.
•"Human beings - like rodents, beavers and deer - are mammals, government scientists confirmed."
•Giant snakes falling from office buildings and eating you.
•QED
The sad thing is, reading the article, I am not sure if he is joking, but I am sure there are some people who will think this is a real threat.
To summarize, there is an introduced population of Burmese pythons in the Everglades, 3100 miles away. A USGS lab used an off the shelf climate model to predict where in the US Burmese Pythons could deal with the climate, and San Francisco (along with pretty much the southern half of the US) showed up as one potential habitat.
The idiot who wrote the article then follows this train of thought to show that pythons will be eating pedestrians on Market Street by 2020:
•One python showed up at Lake Okeechobee, 100 miles north of the Everglades, and in the same direction it would travel if its single-minded goal was to reach Fisherman's Wharf.
•Pythons can travel up to 20 miles a month, and the road to SF is 3000 miles, so it will be here in 150 months, or about 12 years.
•Pythons eat mammals.
•"Human beings - like rodents, beavers and deer - are mammals, government scientists confirmed."
•Giant snakes falling from office buildings and eating you.
•QED
The sad thing is, reading the article, I am not sure if he is joking, but I am sure there are some people who will think this is a real threat.
Wednesday, February 20, 2008
Chemicals of Science
A very kind scientist at McGill sent me samples of four different strains of rotifers, along with the formula for the medium he keeps them in. The rotifers look so lively and healthful that I decided to buy the chemicals and mix up some of his medium. The problem is that while I need a few milligrams of this and a couple of grams of that, nobody sells the stuff in quantities smaller than 500 grams of this and 1kg of that. So at the end of the project, I have almost the entire container left over, and because it came in a form that is so concentrated as to be toxic if swallowed, it all has to be treated as toxic waste. Iron-chloride is not very toxic, but if you swallow 500g you would be very unhappy. So what I will probably end up doing is mixing lots of extra solution, basically making artificial pond water, because that does not need to be disposed of as toxic waste.
I was complaining about all this to some colleagues, who replied that this is a perennial problem, and that almost any time one does lab work, one has to budget for disposal of the left over chemicals, because one can't buy them in small enough quantities. The College of Chemistry on campus has a chemical reuse library for this purpose (drop off unused chemicals with out paying for disposal, pick up extra chemicals without buying a whole container) but they don't allow people from other departments to participate, even if we ask real nice.
I looked through the various suppliers and ordered the smallest quantities possible, even when it cost more.
How thoroughly wasteful and silly this whole system is.
I was complaining about all this to some colleagues, who replied that this is a perennial problem, and that almost any time one does lab work, one has to budget for disposal of the left over chemicals, because one can't buy them in small enough quantities. The College of Chemistry on campus has a chemical reuse library for this purpose (drop off unused chemicals with out paying for disposal, pick up extra chemicals without buying a whole container) but they don't allow people from other departments to participate, even if we ask real nice.
I looked through the various suppliers and ordered the smallest quantities possible, even when it cost more.
How thoroughly wasteful and silly this whole system is.
Key Words
bureaucracy,
chemistry,
economics,
environment,
rotifers,
science as process
Sunday, February 17, 2008
Deep thoughts
It is striking to think that over the billions of years there has been life on earth, there have been countless billions of individual organisms that have died before reproducing successfully, and billions of organisms who would end up being the ancestors of the living things alive on earth today, but there has been absolutely no overlap between these two groups.
Why no "grandfather effect"?
Much of my time at present is consumed by setting up an experimental test of what is known as the grandmother hypothesis. The grandmother hypothesis, in short, is the best guess we have as to why the females of humans and a few other species can live well past the age of reproductive cessation. In most species, and indeed in human males, there is no significant post-reproductive lifespan. Individuals are physiologically capable of reproducing for as long as they live. But the females of humans, a few other primates, a couple of cetations and maybe elephants go through menopause and then can live a significant portion of their lifespan after that. Our closest relatives, the chimps and bonobos, apparently go through menopause at the same age as our females, but live at most a few years after that.
Evolutionarily, this makes sense. If one is no longer increasing one's lifetime reproductive success, staying alive offers no obvious selective advantage. No point in investing in physiologies and structures that will last 100 years if one is only going to reproduce for 50 years. Better to put those resources into having more kids now.
But under a certain set of circumstances, reproduction does not end with, or shortly after, childbirth. If your young aren't really able to take care of themselves for a decade or two, you aren't done reproducing until they don't need you any more. In most hunter gatherer societies, the survival rate of five year olds whose mothers die is quite low. So for human women, having a kid in the last several years of life was likely a waste of time.
Worse, the kid who didn't make it took time and resources that could have been put into other kids, and childbirth, particularly late in life, is dangerous. Plus, elder human females are important for helping their daughters raise their own young, and learn how to do so. It has been shown that young mothers in several societies have a higher success rate raising kids if their mothers are around. The women who stopped having kids and focussed on the kids and grandkids they already had, and avoided the risk of late life childbirth, are thought to have ended up getting more of their genes into future generations than women who kept giving birth as long as they lived. If so, and if this variation in life history was heritable, which seems likely, this differential reproductive success would inevitably lead to a population with more and more women stopping early and fewer and fewer giving birth late in life. This is, we think, why we ended up with this "grandmother effect" of women living well past reproductive age.
The benefit of having a grandmother around seems to be restricted to maternal grandmothers. And this observation, that paternal grandmothers don't seem to make as much of a difference (at least in the societies studied) to the survival of their grandkids, points to at least two possible reasons why we don't see a "grandfather effect" to go along with this "grandmother effect."
First, in most societies, at least those studied in this context, males are providing less in the way of vital care. So if a women has a son who has kids, perhaps she is less involved in care, or in teaching how to care, because her son is not as involved as his mate in that care, and the daughter-in-law is not nearly as likely to look for advice and help from her husband's mother than her own mother. And perhaps this same logic applies to grandfathers on both sides. If they are not who the primary caregiver can go to for help and advice, the advantage of having them around to help is smaller.
Second, paternal grandmothers are less certain of which is really their genetic grandchild. If a woman gives birth to a daughter, and watches that daughter give birth to babies, she can be very confident that those are her descendants. If a woman gives birth to a son, and then watches that husband's mate give birth, there is a significant chance (and we have the genetic data to substantiate this) that the baby was fathered by some other man, and those babies aren't her genetic kin. So investing in them heavily may not be doing her any good. This argument is doubly true for grandfathers. The daughter who is giving birth may not even be his. A couple of generations removed, and who can be sure?
A final reason males may not have evolved to have a post reproductive period comes back to that risk in late life childbirth. Men don't give birth, so the risk to late life survival posed by late life reproduction may be greatly reduced, or completely absent. Without that trade-off, why not keep on breeding as long as possible?
Evolutionarily, this makes sense. If one is no longer increasing one's lifetime reproductive success, staying alive offers no obvious selective advantage. No point in investing in physiologies and structures that will last 100 years if one is only going to reproduce for 50 years. Better to put those resources into having more kids now.
But under a certain set of circumstances, reproduction does not end with, or shortly after, childbirth. If your young aren't really able to take care of themselves for a decade or two, you aren't done reproducing until they don't need you any more. In most hunter gatherer societies, the survival rate of five year olds whose mothers die is quite low. So for human women, having a kid in the last several years of life was likely a waste of time.
Worse, the kid who didn't make it took time and resources that could have been put into other kids, and childbirth, particularly late in life, is dangerous. Plus, elder human females are important for helping their daughters raise their own young, and learn how to do so. It has been shown that young mothers in several societies have a higher success rate raising kids if their mothers are around. The women who stopped having kids and focussed on the kids and grandkids they already had, and avoided the risk of late life childbirth, are thought to have ended up getting more of their genes into future generations than women who kept giving birth as long as they lived. If so, and if this variation in life history was heritable, which seems likely, this differential reproductive success would inevitably lead to a population with more and more women stopping early and fewer and fewer giving birth late in life. This is, we think, why we ended up with this "grandmother effect" of women living well past reproductive age.
The benefit of having a grandmother around seems to be restricted to maternal grandmothers. And this observation, that paternal grandmothers don't seem to make as much of a difference (at least in the societies studied) to the survival of their grandkids, points to at least two possible reasons why we don't see a "grandfather effect" to go along with this "grandmother effect."
First, in most societies, at least those studied in this context, males are providing less in the way of vital care. So if a women has a son who has kids, perhaps she is less involved in care, or in teaching how to care, because her son is not as involved as his mate in that care, and the daughter-in-law is not nearly as likely to look for advice and help from her husband's mother than her own mother. And perhaps this same logic applies to grandfathers on both sides. If they are not who the primary caregiver can go to for help and advice, the advantage of having them around to help is smaller.
Second, paternal grandmothers are less certain of which is really their genetic grandchild. If a woman gives birth to a daughter, and watches that daughter give birth to babies, she can be very confident that those are her descendants. If a woman gives birth to a son, and then watches that husband's mate give birth, there is a significant chance (and we have the genetic data to substantiate this) that the baby was fathered by some other man, and those babies aren't her genetic kin. So investing in them heavily may not be doing her any good. This argument is doubly true for grandfathers. The daughter who is giving birth may not even be his. A couple of generations removed, and who can be sure?
A final reason males may not have evolved to have a post reproductive period comes back to that risk in late life childbirth. Men don't give birth, so the risk to late life survival posed by late life reproduction may be greatly reduced, or completely absent. Without that trade-off, why not keep on breeding as long as possible?
Key Words
Behavior,
demography,
evolution,
family,
Grandmother Hypothesis,
hypotheses,
primates,
reproduction,
senescence
Saturday, February 16, 2008
Deer Populations and Ecological Illiteracy
The New York Times this week has an article about deer overpopulation in New Jersey (although the problem is just as bad throughout the forested northeast) and efforts to control it through culls.
The problem, and reactions to it, demonstrate the deep ecological illiteracy informing both sides of the debate. Groups that value the deer see them as a natural and beautiful part of the landscape. They are beautiful, and individually they are natural, but their populations are much higher than they would ever have been naturally. This is partially because of removal of predators (deer evolved to breed faster than the wolves and mountain lions could eat them) and partially because we have created so much high quality feeding habitat for them. Deer find the easiest and best food at forest edges, and because of human land use there is so much more forest edge than there has ever been before. Somebody or other, maybe Audubon, said that a squirrel could travel from Maine to Louisiana without ever having to come down from the trees. These were big trees with their leaves way up where deer can't reach, and very few breaks. The forests of the east are now young and fragmented; basically an all you can eat for the deer. And we can no longer rely on long snowy winters to cull deer populations every year. As a result, the effects that deer are having on the forest is very far from natural.
Experiments with deer exclosures (basically large fenced areas, chosen randomly in the forest to see what happens without deer) are fairly unambiguous. I've seen these experiments first hand in the old growth forest of upper Michigan. Working for ecologist Dr. Kerry Woods the summer after I graduated from college, one of my tasks was to revisit exclosures he'd built three years earlier. Outside the exclosures, where the deer can get, extremely few seedlings make it. The forest has an open, park like feeling, no understory. The deer population is so dense everything gets mowed. Inside the exclosures, dense hedges of rapidly growing saplings compete for light, but any branch that reaches outside the enclosure is quickly nipped off. This forest that had never been cut by humans was being kept from replacing itself by the deer overpopulation. The same pattern is being found all over the north-east.
But if the people who see the deer as wonderful parts of nature are ignoring ecology, they are not alone. Those who see deer overpopulation as a problem generally ignore the same ecological facts. Governments organize huge one time culls in limited areas, and are then surprised when deer from next door are attracted by the unexploited greenery. Deer populations with plenty of food and few predators can double every two years or so. Shoot 1500 out of 2000 deer in your county and four years later you are back where you started, even if you don't have deer moving in from adjoining counties.
Basic arithmetic tells us that until White Tailed Deer mortality rates exceed birth rates throughout the northeast, the regional population will not decline. Birthrates are unlikely to decline, unless the structure of the current forest changes so much that the deer are nutritionally limited. Not likely. And plans to control the wild regional population through some sort of sterilization program strike me as ludicrously expensive and incredibly unlikely to work.
So what causes mortality? Disease, winter, cars, predators, hunters. Disease we don't want to encourage, especially considering that many diseases that affect deer can also fell horses, sheep, cows and such. Winters are tending weaker. Sever storms are increasing, but to really knock back the deer population, one needs a winter that is very cold and snowy for months over a large area. Not likely. Few would advocate increased car-deer collisions. Hunters are limited in where they can hunt by the danger of bullets carrying to nearby houses, roads and such. And hunting seasons are limited, in part to make forests safe for other uses the rest of the year. There is also mounting evidence that deer hunters regularly dose themselves and their families with lead when they bring the carcass home. Natural predators are few and far between in the northeast, although coyotes are becoming both more common and larger, making it easier for them to bring deer down. The traditional predators, wolves and mountain lions, are unlikely to be restored to populations in the northeast sufficient to keep the deer in check.
So if reducing deer populations is important and none of our current strategies seem promising, what do I suggest? Integrated pest management. Look at the problem on a broad geographic scale, understand the demography in as much detail as we can, and figure out what the vulnerable point in the demographic cycle is. As an example, hunting seasons were traditionally in the fall and winter, exactly because hunting then reduces the deer herd the least. Fewer winter deaths, no pregnant does, few dependant young. If we really want to keep deer populations down, hunting should be done in the spring. Hunters have traditionally hoped for a buck. But killing a buck does basically nothing to reduce the population in the long term. Some other buck will be happy to inseminate all the does. One buck and a hundred does will produce just as many fawns as one hundred bucks and one hundred does. If our goal is to bring the population down, we need to target does, and let hunters take as many as they please, perhaps requiring the donation of excess meat to charitable food pantries. And we should do it with non-lead ammunition, so we don't poisoning ourselves in the process. And we should be honest enough to admit that we are going to have to do this every year in perpetuity, until the ecology of the northeast changes enough that deer populations are regulated naturally.
The problem, and reactions to it, demonstrate the deep ecological illiteracy informing both sides of the debate. Groups that value the deer see them as a natural and beautiful part of the landscape. They are beautiful, and individually they are natural, but their populations are much higher than they would ever have been naturally. This is partially because of removal of predators (deer evolved to breed faster than the wolves and mountain lions could eat them) and partially because we have created so much high quality feeding habitat for them. Deer find the easiest and best food at forest edges, and because of human land use there is so much more forest edge than there has ever been before. Somebody or other, maybe Audubon, said that a squirrel could travel from Maine to Louisiana without ever having to come down from the trees. These were big trees with their leaves way up where deer can't reach, and very few breaks. The forests of the east are now young and fragmented; basically an all you can eat for the deer. And we can no longer rely on long snowy winters to cull deer populations every year. As a result, the effects that deer are having on the forest is very far from natural.
Experiments with deer exclosures (basically large fenced areas, chosen randomly in the forest to see what happens without deer) are fairly unambiguous. I've seen these experiments first hand in the old growth forest of upper Michigan. Working for ecologist Dr. Kerry Woods the summer after I graduated from college, one of my tasks was to revisit exclosures he'd built three years earlier. Outside the exclosures, where the deer can get, extremely few seedlings make it. The forest has an open, park like feeling, no understory. The deer population is so dense everything gets mowed. Inside the exclosures, dense hedges of rapidly growing saplings compete for light, but any branch that reaches outside the enclosure is quickly nipped off. This forest that had never been cut by humans was being kept from replacing itself by the deer overpopulation. The same pattern is being found all over the north-east.
But if the people who see the deer as wonderful parts of nature are ignoring ecology, they are not alone. Those who see deer overpopulation as a problem generally ignore the same ecological facts. Governments organize huge one time culls in limited areas, and are then surprised when deer from next door are attracted by the unexploited greenery. Deer populations with plenty of food and few predators can double every two years or so. Shoot 1500 out of 2000 deer in your county and four years later you are back where you started, even if you don't have deer moving in from adjoining counties.
Basic arithmetic tells us that until White Tailed Deer mortality rates exceed birth rates throughout the northeast, the regional population will not decline. Birthrates are unlikely to decline, unless the structure of the current forest changes so much that the deer are nutritionally limited. Not likely. And plans to control the wild regional population through some sort of sterilization program strike me as ludicrously expensive and incredibly unlikely to work.
So what causes mortality? Disease, winter, cars, predators, hunters. Disease we don't want to encourage, especially considering that many diseases that affect deer can also fell horses, sheep, cows and such. Winters are tending weaker. Sever storms are increasing, but to really knock back the deer population, one needs a winter that is very cold and snowy for months over a large area. Not likely. Few would advocate increased car-deer collisions. Hunters are limited in where they can hunt by the danger of bullets carrying to nearby houses, roads and such. And hunting seasons are limited, in part to make forests safe for other uses the rest of the year. There is also mounting evidence that deer hunters regularly dose themselves and their families with lead when they bring the carcass home. Natural predators are few and far between in the northeast, although coyotes are becoming both more common and larger, making it easier for them to bring deer down. The traditional predators, wolves and mountain lions, are unlikely to be restored to populations in the northeast sufficient to keep the deer in check.
So if reducing deer populations is important and none of our current strategies seem promising, what do I suggest? Integrated pest management. Look at the problem on a broad geographic scale, understand the demography in as much detail as we can, and figure out what the vulnerable point in the demographic cycle is. As an example, hunting seasons were traditionally in the fall and winter, exactly because hunting then reduces the deer herd the least. Fewer winter deaths, no pregnant does, few dependant young. If we really want to keep deer populations down, hunting should be done in the spring. Hunters have traditionally hoped for a buck. But killing a buck does basically nothing to reduce the population in the long term. Some other buck will be happy to inseminate all the does. One buck and a hundred does will produce just as many fawns as one hundred bucks and one hundred does. If our goal is to bring the population down, we need to target does, and let hunters take as many as they please, perhaps requiring the donation of excess meat to charitable food pantries. And we should do it with non-lead ammunition, so we don't poisoning ourselves in the process. And we should be honest enough to admit that we are going to have to do this every year in perpetuity, until the ecology of the northeast changes enough that deer populations are regulated naturally.
Key Words
demography,
ecological illiteracy,
ecology,
environment,
lead,
megafauna,
urban wildlife
Brown Creeper
There are certain birds that, based on experience, I can place a very high prior probability on finding in any patch of trees around here. Anna's Hummingbird. American Robin, California Towhee, Ruby-Crowned Kinglet and so on. They're there, I can find them quickly. Most of these species made my bird list for El Cerrito Hillside Natural Area within the first day or two. But there is one bird I have high confidence is in all these patches, but not high confidence in finding. And that is the Brown Creeper, Certhia americana. The Brown Creeper, as its name suggests, is not a flashy bird. Small, brown, spotted for camo, the only American representative of the family Certhidae moves like its old world relatives; it creeps, foot over foot, up surfaces (in this case the trunks of trees) probing cracks and crevasses with its wrenish bill, looking for arthropods. It doesn't make a lot of noise, it doesn't make sudden movements, it is an extremely common bird that most people will never see unless they look for it. I have seen people walk past Brown Creepers that are at head height, five feet from their eyes and in full view, and never know the bird is there.
So I have had my eyes and ears open for the little sneakers ever since we moved to El Cerrito, and been continuously thwarted. Occasionally I will see a flash as something shoots past, flapping like a creeper flaps, but been unable to get a good enough look to confirm the identity. I have heard what I thought was creepers but couldn't be sure. But this morning, Iris and I went for a short walk under the oaks just outside our back yard, and a flash of bitty wings caught my eyes. My brain said "Creeper!" I swung around, unwilling to take my eyes off it as it flitted this way and that through the branches, and then dropped, coming to rest on a tree trunk ten meters from us, fully visible only because my brain knew it was there. Iris and I both raised our binoculars. Sure enough, a Brown Creeper, trickling up the trunk. That swaying foot over foot climbing makes the bird move more like a wavering shadow than a living thing, and the speckles on the bird's back looked like little bits of every kind of bark in the forest. Being reminded of this, I felt a little bit of pride at having spotted this very common backyard bird. I'm sure there are hundreds of them back there.
So I have had my eyes and ears open for the little sneakers ever since we moved to El Cerrito, and been continuously thwarted. Occasionally I will see a flash as something shoots past, flapping like a creeper flaps, but been unable to get a good enough look to confirm the identity. I have heard what I thought was creepers but couldn't be sure. But this morning, Iris and I went for a short walk under the oaks just outside our back yard, and a flash of bitty wings caught my eyes. My brain said "Creeper!" I swung around, unwilling to take my eyes off it as it flitted this way and that through the branches, and then dropped, coming to rest on a tree trunk ten meters from us, fully visible only because my brain knew it was there. Iris and I both raised our binoculars. Sure enough, a Brown Creeper, trickling up the trunk. That swaying foot over foot climbing makes the bird move more like a wavering shadow than a living thing, and the speckles on the bird's back looked like little bits of every kind of bark in the forest. Being reminded of this, I felt a little bit of pride at having spotted this very common backyard bird. I'm sure there are hundreds of them back there.
Friday, February 15, 2008
Journal of the American Forehead Slapping Assosciation
In another big no-shock-shocker that needed to be demonstrated anyway, It has been found that when poor women are given vouchers to local farmers' markets, their families eat more fruits and vegetables. While anyone with two axons to rub together could have predicted this, I am still glad they took the time to prove it.
METHODS: Women who enrolled for postpartum services (n=602) at 3 WIC sites in Los Angeles were assigned to an intervention (farmers' market or supermarket, both with redeemable food vouchers) or control condition (a minimal nonfood incentive). Interventions were carried out for 6 months, and participants' diets were followed for an additional 6 months. RESULTS: Intervention participants increased their consumption of fruits and vegetables and sustained the increase 6 months after the intervention was terminated (model adjusted R(2)=.13, P<.001). Farmers' market participants showed an increase of 1.4 servings per 4186 kJ (1000 kcal) of consumed food (P<.001) from baseline to the end of intervention compared with controls, and supermarket participants showed an increase of 0.8 servings per 4186 kJ (P=.02). CONCLUSIONS: Participants valued fresh fruits and vegetables, and adding them to the WIC food packages will result in increased fruit and vegetable consumption.
METHODS: Women who enrolled for postpartum services (n=602) at 3 WIC sites in Los Angeles were assigned to an intervention (farmers' market or supermarket, both with redeemable food vouchers) or control condition (a minimal nonfood incentive). Interventions were carried out for 6 months, and participants' diets were followed for an additional 6 months. RESULTS: Intervention participants increased their consumption of fruits and vegetables and sustained the increase 6 months after the intervention was terminated (model adjusted R(2)=.13, P<.001). Farmers' market participants showed an increase of 1.4 servings per 4186 kJ (1000 kcal) of consumed food (P<.001) from baseline to the end of intervention compared with controls, and supermarket participants showed an increase of 0.8 servings per 4186 kJ (P=.02). CONCLUSIONS: Participants valued fresh fruits and vegetables, and adding them to the WIC food packages will result in increased fruit and vegetable consumption.
Key Words
agriculture,
blatantly obvious,
California,
economics,
nutrition,
sociology
Friday, February 08, 2008
Citizen science, and the limits thereof
One of my neighbors sent me a copy of a list that she was given by the people who sold her her house. They told her they saw all these species in El Cerrito Hillside Natural Area. At first was excited to see this list, and the first several species on there are quite reasonable, but a more careful look significantly lowered my level of confidence in these observations. This is a perfect example of why "citizen science" projects that rely on non-experts to gather natural history data require great care. Below I have pasted in the list, with some comments.
chestnut-backed chickadee
common bushtit
turkey vulture
cooper's hawk
american kestrel
red-tailed hawk
common crow
common raven
great-horned owl
ruby-crowned kinglet
woodthrush (Does not occur in CA, probably Hermit Thrush)
red-shafted flicker
winter wren
hairy woodpecker
downy woodpecker
robin
brown towee (Californa Towhee)
rufous-sided towee (Spotted Towhee)
oregon junco (Dark-Eyed Junco)
purple finch
house finch
pine siskin
wilson's warbler
tennessee warbler (does not occur in CA, Orange-Crowned Warbler)
american goldfinch
lesser goldfinch
lawrence's goldfinch
mockingbird
plain titmouse (Oak Titmouse)
scrub jay
steller's jay
mexican jay (Does not occur in CA, probably juv. scrub-jay)
cedar waxwing
western wood pewee
mourning dove
bead-tailed pigeon (Band-tailed Pigeon)
fox sparrow
savannah sparrow
harris's sparrow (Does not occur in CA, probably House Sparrow)
golden-crowned sparrow
starling
anna's hummingbird
allen's hummingbird
black phoebe
wrentit
marsh hawk (Same as Northern Harrier, listed below)
swainsons's thrush (possible)
mississippi kite (Does not occur in CA, probably Northern Harrier)
rufous hummingbird (nearly impossible to tell from Allen's except in hand)
canada goose
brown pelican (in park or flying in distance over bay?)
slate-colored junco (same as junco listed above)
warbling vireo
lazuli bunting (possible)
western tanager
bluegray gnatcatcher
empidonax flycatcher
bewick's wren
yellow-rumped warbler
townsend's warbler
hermit thrush
myrtle warbler (same as Yellow-rumped arbler)
osprey
beardless flycatcher (not found in CA)
red-breasted nuthatch
white warbler (not a real species, no idea)
chestnut-backed chickadee
common bushtit
turkey vulture
cooper's hawk
american kestrel
red-tailed hawk
common crow
common raven
great-horned owl
ruby-crowned kinglet
woodthrush (Does not occur in CA, probably Hermit Thrush)
red-shafted flicker
winter wren
hairy woodpecker
downy woodpecker
robin
brown towee (Californa Towhee)
rufous-sided towee (Spotted Towhee)
oregon junco (Dark-Eyed Junco)
purple finch
house finch
pine siskin
wilson's warbler
tennessee warbler (does not occur in CA, Orange-Crowned Warbler)
american goldfinch
lesser goldfinch
lawrence's goldfinch
mockingbird
plain titmouse (Oak Titmouse)
scrub jay
steller's jay
mexican jay (Does not occur in CA, probably juv. scrub-jay)
cedar waxwing
western wood pewee
mourning dove
bead-tailed pigeon (Band-tailed Pigeon)
fox sparrow
savannah sparrow
harris's sparrow (Does not occur in CA, probably House Sparrow)
golden-crowned sparrow
starling
anna's hummingbird
allen's hummingbird
black phoebe
wrentit
marsh hawk (Same as Northern Harrier, listed below)
swainsons's thrush (possible)
mississippi kite (Does not occur in CA, probably Northern Harrier)
rufous hummingbird (nearly impossible to tell from Allen's except in hand)
canada goose
brown pelican (in park or flying in distance over bay?)
slate-colored junco (same as junco listed above)
warbling vireo
lazuli bunting (possible)
western tanager
bluegray gnatcatcher
empidonax flycatcher
bewick's wren
yellow-rumped warbler
townsend's warbler
hermit thrush
myrtle warbler (same as Yellow-rumped arbler)
osprey
beardless flycatcher (not found in CA)
red-breasted nuthatch
white warbler (not a real species, no idea)
Key Words
birds,
citizen science,
data,
El Cerrito Hillside Natural Area,
Natural History
El Cerrito Hillside Natural Area, February list
Here is the February list. 53 species are listed at present.
Birds:
Western Scrub-Jay
Stellar's Jay
American Crow
Northern Raven
Hutton's Vireo
Black Phoebe
Yellow-rumped Warblers
Townsend's Warbler
Brown Creeper
Bewick's Wren
Chestnut-backed Chickadee
Oak Titmouse
House Sparrow
Ruby-Crowned Kinglet
Golden-Crowned Kinglet
American Robin
Bush Tit
Hermit Thrush
Northern Mockingbird
White-crowned Sparrow
Golden-crowned Sparrow
Song Sparrow
Spotted Towhee
California Towhee
Dark-eyed Junco
Cedar Waxwing
American Goldfinch
Lesser Goldfinch
Pine Siskin
House Finch
Wild Turkey
Cooper's Hawk
Red-tailed Hawk
Red-shouldered Hawk
American Kestrel
Great Horned Owl
Red-breasted Nuthatch
Downy Woodpecker
Red-shafted Flicker
Red-breasted Sapsucker
Nuttall's Woodpecker
Anna's Hummingbird
Selasphorus Hummingbird (Either Allen's or Rufous, two nearly indistinguishable)
Turkey Vulture
American Coot
Double-crested Cormorant
Ring-Billed Gull
Rock Pigeon
Mourning Dove
Mammals:
Eastern Fox Squirrel (Sciurus niger)
Mule Dear (Odocoileus hemionus)
Voles (Microtus californicus? runways and burrows)
Pocket Gophers (burrows)
Fox (Grey fox? scat)
Skunk (smelled, species?)
Herps:
Southern Alligator Lizard (Elgaria multicarinata)
California Slender Salamander (Batrachoseps attenuatus)
Arboreal Salamander (Aneides lugubris)
Birds:
Western Scrub-Jay
Stellar's Jay
American Crow
Northern Raven
Hutton's Vireo
Black Phoebe
Yellow-rumped Warblers
Townsend's Warbler
Brown Creeper
Bewick's Wren
Chestnut-backed Chickadee
Oak Titmouse
House Sparrow
Ruby-Crowned Kinglet
Golden-Crowned Kinglet
American Robin
Bush Tit
Hermit Thrush
Northern Mockingbird
White-crowned Sparrow
Golden-crowned Sparrow
Song Sparrow
Spotted Towhee
California Towhee
Dark-eyed Junco
Cedar Waxwing
American Goldfinch
Lesser Goldfinch
Pine Siskin
House Finch
Wild Turkey
Cooper's Hawk
Red-tailed Hawk
Red-shouldered Hawk
American Kestrel
Great Horned Owl
Red-breasted Nuthatch
Downy Woodpecker
Red-shafted Flicker
Red-breasted Sapsucker
Nuttall's Woodpecker
Anna's Hummingbird
Selasphorus Hummingbird (Either Allen's or Rufous, two nearly indistinguishable)
Turkey Vulture
American Coot
Double-crested Cormorant
Ring-Billed Gull
Rock Pigeon
Mourning Dove
Mammals:
Eastern Fox Squirrel (Sciurus niger)
Mule Dear (Odocoileus hemionus)
Voles (Microtus californicus? runways and burrows)
Pocket Gophers (burrows)
Fox (Grey fox? scat)
Skunk (smelled, species?)
Herps:
Southern Alligator Lizard (Elgaria multicarinata)
California Slender Salamander (Batrachoseps attenuatus)
Arboreal Salamander (Aneides lugubris)
Key Words
birds,
El Cerrito Hillside Natural Area,
Natural History,
Vertebrates
Sunday, February 03, 2008
Mixed-Species Flock
I've been seeing a lot of cedar waxwings and robins recently, and I'm used to seeing them together, but Saturday in our backyard was the biggest mixed flock of these two species Ive ever seen. Forty birds shooting this way and fifty coming back that way, a clamor of robin whinnies and waxwing whistles from ever tree and bush. The robins numbered in the hundreds and waxwings outnumbered them, but in the whirling bickering flock, I couldn't really tell how many hundreds there were. There were American and Lesser Goldfinches, Chestnut-backed Chickadees, Oak Titmice and at least one Bewick's Wren feeding with the flock. Anything with berries on it was covered in birds, coming, filling their bellies and quickly being replaced by the next wave. I took the opportunity to take a couple of hundred photos, although most of them ended up with streaks as other birds flew into, out of, or through the frame. Some of the best shots are in this album.
I also took the opportunity to teach Iris how to identify these species. She asked the excellent question of why all there birds were moving around together, when it seemed like they were all squabbling over the same food. This is actually a questions several scientists have looked into, and the answer seems to be that like most things, one has to consider the costs and benefits. When the costs of participating in the flock (competition for food, time lost arguing) are outweighed by the benefits (protection in numbers from predators, more guides looking for food) then the birds flock. In the case of waxwings and robins, they are looking for a very patchy resource. While a bush is making berries, it is hard for even a huge flock to use up all the food, but the good berry bushes may be rare. So the cost of competition is low, because there is so much food on each bush, but the benefit is high, because by following the flock one doesn't have to waste time finding the food. Go where the flock is loudest and there is sure to be a bush covered in berries. And with so many eyes around, no predator could possibly sneak up. I saw one scrub-jay (which will occasionally kill and eat smaller birds) being chased by about 40 waxwings and a couple of chickadees. Once the jay was well away, they all went back to feeding.
![]() |
| ECHNA Birds |
Friday, January 25, 2008
El Cerrito Hillside Natural Area, bird walk
Whenever we have a dry weekend, I am going to be leading a bird walk for people who live around the El Cerrito Hillside Natural Area. I expect that most of them don't own binoculars, so I will be concentrating on teaching them how to recognize the common birds by ear. It should be interesting. Others are welcome to come. If you are interested, let me know.
Key Words
birds,
El Cerrito Hillside Natural Area,
teaching
Thursday, January 24, 2008
Life. Life. What is it?
Biology is often described as the scientific study of life. Which is a pretty good definition, so long as you understand the biological definition of life. What is the biological definition of life? Well, I'm not sure there is one. We are pretty sure humans are alive, as are our individual cells. Plants, fungi, bacteria, these we know are alive. They have cells bounded by membranes. They have genetic material. They grow and reproduce. They exchange gasses with their environment and maintain their internal order by taking in low entropy material and putting out high entropy material.
In high school biology, I was told that viruses are not alive. They are like pieces of paper that say "Photocopy me!" They cause themselves to be replicated, but they don't actually self replicate. They don't grow. They don't exchange gasses. They don't take in low entropy material and put out high entropy material. They don't have a membrane.
Prions, misfolded proteins which cause other similar proteins to misfold in the same way, are even further from the traditional definition than are viruses. Viruses at least have their own genetic material. Prions don't. Therefore, not alive.
But we must be careful about phenomenological definitions. If we define Zebra as "an equid with stripes" then we can make any horse into a zebra by painting stripes on it, and an albino foal born to a zebra mother and zebra father would not a zebra. But an albino zebra is a zebra, and so while stripes are a prominent characteristic of zebrasity they are not a defining one.
So we must be wary of defining things in ways that they have to have some arbitrarily chosen us-like characteristic to qualify. Anthropocentrism is so uncool, and so limiting. Why does life need to have cells bounded by membranes? When earth is invaded by aliens who's tissues don't consist of cells bounded by membranes, are we going to insist that they aren't alive? I hope not. If on Mars we find some manner of critter that self replicates, exchanges gases and takes in low entropy matter/energy in order to maintain a low internal entropy state, but is without genetic material, are we going to say, "damn, we thought we might have life here, too bad?" No. We would say how amazing yet expectable it was that Martian life does it differently than we do.
So I don't quite know what life is, but looking again at that list from my high school biology class, there are certain criteria that make more sense than others. The "cells bounded by membranes" criterion is foolish, based only on the fact that we have only ever observed one related group of living things. It is like defining humans as light skinned after a visit to one family in Norway. The "has genetic material" criterion makes a bit more sense. I would rephrase it as "makes offspring that are more similar to themselves than would be expected randomly." The "grow and reproduce" thing is really two criteria. Growth, I think, is like the zebra's stripes. If we found beings that were built at full size by their parents, and then went on to make offspring that at the beginning of their lives were also full sized, but had high alivitude in every other way, I think we would recognize them as alive. Reproduction, on the other hand, seems a necessary component of a living system. Individuals who don't reproduce can be alive, but it is difficult to imagine a system in which life persists without reproduction. The "exchange gasses with their environment" malarkey is pure chauvinism. Most living things we know do, but is this a defining characteristic? No. "Maintains internal order by taking in low entropy mass/energy and putting out high entropy mass/entropy" is I think, inescapable for any lifeform.
So biology is (maybe) the study of entities or phenomena which make offspring that are more similar to themselves than would be expected randomly (in other words reproduce) and maintains internal order by taking in low entropy mass/energy and putting out high entropy mass/entropy. I'll have to think about this definition and see if I can think of counter-examples.
In high school biology, I was told that viruses are not alive. They are like pieces of paper that say "Photocopy me!" They cause themselves to be replicated, but they don't actually self replicate. They don't grow. They don't exchange gasses. They don't take in low entropy material and put out high entropy material. They don't have a membrane.
Prions, misfolded proteins which cause other similar proteins to misfold in the same way, are even further from the traditional definition than are viruses. Viruses at least have their own genetic material. Prions don't. Therefore, not alive.
But we must be careful about phenomenological definitions. If we define Zebra as "an equid with stripes" then we can make any horse into a zebra by painting stripes on it, and an albino foal born to a zebra mother and zebra father would not a zebra. But an albino zebra is a zebra, and so while stripes are a prominent characteristic of zebrasity they are not a defining one.
So we must be wary of defining things in ways that they have to have some arbitrarily chosen us-like characteristic to qualify. Anthropocentrism is so uncool, and so limiting. Why does life need to have cells bounded by membranes? When earth is invaded by aliens who's tissues don't consist of cells bounded by membranes, are we going to insist that they aren't alive? I hope not. If on Mars we find some manner of critter that self replicates, exchanges gases and takes in low entropy matter/energy in order to maintain a low internal entropy state, but is without genetic material, are we going to say, "damn, we thought we might have life here, too bad?" No. We would say how amazing yet expectable it was that Martian life does it differently than we do.
So I don't quite know what life is, but looking again at that list from my high school biology class, there are certain criteria that make more sense than others. The "cells bounded by membranes" criterion is foolish, based only on the fact that we have only ever observed one related group of living things. It is like defining humans as light skinned after a visit to one family in Norway. The "has genetic material" criterion makes a bit more sense. I would rephrase it as "makes offspring that are more similar to themselves than would be expected randomly." The "grow and reproduce" thing is really two criteria. Growth, I think, is like the zebra's stripes. If we found beings that were built at full size by their parents, and then went on to make offspring that at the beginning of their lives were also full sized, but had high alivitude in every other way, I think we would recognize them as alive. Reproduction, on the other hand, seems a necessary component of a living system. Individuals who don't reproduce can be alive, but it is difficult to imagine a system in which life persists without reproduction. The "exchange gasses with their environment" malarkey is pure chauvinism. Most living things we know do, but is this a defining characteristic? No. "Maintains internal order by taking in low entropy mass/energy and putting out high entropy mass/entropy" is I think, inescapable for any lifeform.
So biology is (maybe) the study of entities or phenomena which make offspring that are more similar to themselves than would be expected randomly (in other words reproduce) and maintains internal order by taking in low entropy mass/energy and putting out high entropy mass/entropy. I'll have to think about this definition and see if I can think of counter-examples.
Key Words
biology,
definitions,
life,
xenobiology,
zebra
Thursday, January 17, 2008
Origin of my genetic ponderings
As often happens with me, the harder I work on one thing, the more I get really interested in some completely unrelated distraction. My CTIX colleague Robert Horton refers to this as "dynamic shirking".
However, there were a few starting points. First, I have been noticing all the wonderful similarities and differences between my two daughters, and how they compare to Nissa and I. Besides the straightforward one-to-one inheritance of features (who's nose does she have), I was noticing some of what appeared to me to be quantitative variation (although I have not actually measured anything). This first hand experience got me thinking,"How does this whole inheritance thing really work?"
I realized that there were some very fundamental things I didn't have answers for.
Also I was reading through your Glossary post recently, and that got me thinking too.
However, there were a few starting points. First, I have been noticing all the wonderful similarities and differences between my two daughters, and how they compare to Nissa and I. Besides the straightforward one-to-one inheritance of features (who's nose does she have), I was noticing some of what appeared to me to be quantitative variation (although I have not actually measured anything). This first hand experience got me thinking,"How does this whole inheritance thing really work?"
I realized that there were some very fundamental things I didn't have answers for.
Also I was reading through your Glossary post recently, and that got me thinking too.
Tuesday, January 15, 2008
Numeric encoding in DNA
Stephen-
That is another question that is somewhat outside my area of knowledge, but I can tell you what I know. Number can be encoded in DNA in several ways. The most basic is that different individuals can have different numbers of copies of the same gene. Our chromosomes have lots of stretches of DNA that have been duplicated, sometimes many times. Something in the DNA replication process screws up, and you end up repeating a section of the chromosome, like a record skipping while you are making a copy of it. So if I have 2 copies of a gene, and you have 12, that is numeric information. Similar, but not necessarily to the point, are tandem repeats such as microsatellites. This is basically a stutter in (usually non-coding) DNA. A section of chromosome might have ATCATCATCATCATCATCATCATC so that is eight repeats. The other chromosome in the same person could have twelve repeats, and someone else could have 23. These things seem to combine a high mutation rate with very little selective pressure, meaning that they can evolve relatively randomly and very quickly, meaning they are very diverse within a population. For that reason they are often used for genealogical reconstructions and such.
Not exactly numeric, but not binary, is gene expression modulation. Genes are not necessarily just "on" or "off." A wide range of factors can turn up or down the expression a particular gene, including the particulars of the interactions of non-coding DNA in the promoter region at the beginning of that gene with the various promoter or repressers , which can themselves vary in concentration and structure. So the production from a gene is not 0 or 1 but rather can vary continuously from 0 to 1.
On the subject of telomeres, what their length determines is the number of times a cell can divide before its line dies out. This does not so much encode longevity, as take a part in determining the tradeoff between ability to heal and cancer risk. The body has many mechanisms that limit the ability of cells to divide rapidly, which reduces the risk of cancers (which are defined in part by their unchecked cell division)
but also limits healing (which requires cell division). Telomeres are one such mechanism. It is important to keep in mind though that there are enzymes that can extend telomeres, even in adult organisms, and most organisms have telomeres that are much longer than is needed for most of their cell lines to continue dividing throughout their lifetimes, and therefore telomeres are not in any meaningful sense coding for longevity.
I am sure there are other mechanisms of numeric encoding in genetic material, but I don't know what they are.
In response to your question about averaging of parental values, I would say this generally does not happen. For highly heritable traits, the mean value of the offspring should be similar to the mean value of the parents, but it is not the case that every individual offspring will be at or near that mean value. This is a point that is actually extremely important. During Darwin's time, there was a Scottish biologist whose name I can't remember now, who showed mathematically that if offspring get the mean value of their parents, Darwinian evolution does not work very well (effectively because variation is constantly being eliminated). Darwin was stumped for at least a while, until it was pointed out that each offspring does not get that mean value, but rather some value in a range centered on that mean. As an example, my brother is taller than either of my parents (even adjusting for sex) I am about the same height as my parents (again adjusting for sex) and my sister is (again adjusting) shorter than either of my parents.
So I am curious why you are asking all these questions about quantitative genetics. I assume you have had some idea for which genetics is a good analogy?
-Dan
That is another question that is somewhat outside my area of knowledge, but I can tell you what I know. Number can be encoded in DNA in several ways. The most basic is that different individuals can have different numbers of copies of the same gene. Our chromosomes have lots of stretches of DNA that have been duplicated, sometimes many times. Something in the DNA replication process screws up, and you end up repeating a section of the chromosome, like a record skipping while you are making a copy of it. So if I have 2 copies of a gene, and you have 12, that is numeric information. Similar, but not necessarily to the point, are tandem repeats such as microsatellites. This is basically a stutter in (usually non-coding) DNA. A section of chromosome might have ATCATCATCATCATCATCATCATC so that is eight repeats. The other chromosome in the same person could have twelve repeats, and someone else could have 23. These things seem to combine a high mutation rate with very little selective pressure, meaning that they can evolve relatively randomly and very quickly, meaning they are very diverse within a population. For that reason they are often used for genealogical reconstructions and such.
Not exactly numeric, but not binary, is gene expression modulation. Genes are not necessarily just "on" or "off." A wide range of factors can turn up or down the expression a particular gene, including the particulars of the interactions of non-coding DNA in the promoter region at the beginning of that gene with the various promoter or repressers , which can themselves vary in concentration and structure. So the production from a gene is not 0 or 1 but rather can vary continuously from 0 to 1.
On the subject of telomeres, what their length determines is the number of times a cell can divide before its line dies out. This does not so much encode longevity, as take a part in determining the tradeoff between ability to heal and cancer risk. The body has many mechanisms that limit the ability of cells to divide rapidly, which reduces the risk of cancers (which are defined in part by their unchecked cell division)
but also limits healing (which requires cell division). Telomeres are one such mechanism. It is important to keep in mind though that there are enzymes that can extend telomeres, even in adult organisms, and most organisms have telomeres that are much longer than is needed for most of their cell lines to continue dividing throughout their lifetimes, and therefore telomeres are not in any meaningful sense coding for longevity.
I am sure there are other mechanisms of numeric encoding in genetic material, but I don't know what they are.
In response to your question about averaging of parental values, I would say this generally does not happen. For highly heritable traits, the mean value of the offspring should be similar to the mean value of the parents, but it is not the case that every individual offspring will be at or near that mean value. This is a point that is actually extremely important. During Darwin's time, there was a Scottish biologist whose name I can't remember now, who showed mathematically that if offspring get the mean value of their parents, Darwinian evolution does not work very well (effectively because variation is constantly being eliminated). Darwin was stumped for at least a while, until it was pointed out that each offspring does not get that mean value, but rather some value in a range centered on that mean. As an example, my brother is taller than either of my parents (even adjusting for sex) I am about the same height as my parents (again adjusting for sex) and my sister is (again adjusting) shorter than either of my parents.
So I am curious why you are asking all these questions about quantitative genetics. I assume you have had some idea for which genetics is a good analogy?
-Dan
Key Words
demography,
genetics,
quantitative genetics,
telomeres
Numeric encoding in DNA?
What about the possibility that a single section of DNA could directly encode a number, rather than that number be only indirectly determined through the outcome of a multi-step process, specified by multiple genes? (which I agree is the norm)
The only example that I am aware of like this is the telemeres at the end of DNA strands. However, although they do directly quantify the number of times the DNA can be replicated as encoded in their length, the resulting trait of lifespan is obviously affected by many other factors.
Is it possible that some other regulatory genetic sequences operate like this, encoding a number in the length of the sequence?
All in all, I agree with your description of how resulting physical traits take on a continuous spread of values through a mixture of accident and complexity. And in the absence of enviromental differences, each trait is determined from the DNA through a process that can be unique to that subsystem that exhibits it. So in that sense, there are a dense jungle of different types of pathways that map the DNA to the numeric values of our traits.
I also gather from your description that most of the information in the network of genes that help to determine a trait, is ultimately stored in binary form. With a sufficient number of these genetic bits, a continuum of values can be well approximated. It is just how that information maps into a trait, which is what varies from system to system.
It is interesting that despite this complexity, it often is the case that certain traits in an offspring can end up being what appears to be a simple weighted average of the traits of the parents. When you think about though, the genetic reshuffling that occurs as parents' DNA merge, does not allow anthing like an operation of "taking the average". Fundamentally inheritance is boolean and alleles are either passed on or not.
On the other hand...
Hypothetically, if you did have "numeric" genetic sequences, averaging of the values might take the form of a new kind of dominance relationship between the pair of alleles. If they were neutrally dominant, half the time one value would be used, and the other half the time a different value would be expressed. This could result in a fluctuating production level of a hormone which over a short time would average out to the midpoint of the parents' values. Of course, in another situation this could result in the left arm being several inches longer than the right.
It is fun to kick these ideas around a bit.
- Stephen
The only example that I am aware of like this is the telemeres at the end of DNA strands. However, although they do directly quantify the number of times the DNA can be replicated as encoded in their length, the resulting trait of lifespan is obviously affected by many other factors.
Is it possible that some other regulatory genetic sequences operate like this, encoding a number in the length of the sequence?
All in all, I agree with your description of how resulting physical traits take on a continuous spread of values through a mixture of accident and complexity. And in the absence of enviromental differences, each trait is determined from the DNA through a process that can be unique to that subsystem that exhibits it. So in that sense, there are a dense jungle of different types of pathways that map the DNA to the numeric values of our traits.
I also gather from your description that most of the information in the network of genes that help to determine a trait, is ultimately stored in binary form. With a sufficient number of these genetic bits, a continuum of values can be well approximated. It is just how that information maps into a trait, which is what varies from system to system.
It is interesting that despite this complexity, it often is the case that certain traits in an offspring can end up being what appears to be a simple weighted average of the traits of the parents. When you think about though, the genetic reshuffling that occurs as parents' DNA merge, does not allow anthing like an operation of "taking the average". Fundamentally inheritance is boolean and alleles are either passed on or not.
On the other hand...
Hypothetically, if you did have "numeric" genetic sequences, averaging of the values might take the form of a new kind of dominance relationship between the pair of alleles. If they were neutrally dominant, half the time one value would be used, and the other half the time a different value would be expressed. This could result in a fluctuating production level of a hormone which over a short time would average out to the midpoint of the parents' values. Of course, in another situation this could result in the left arm being several inches longer than the right.
It is fun to kick these ideas around a bit.
- Stephen
Subscribe to:
Posts (Atom)
