Friday, January 25, 2008
El Cerrito Hillside Natural Area, bird walk
Whenever we have a dry weekend, I am going to be leading a bird walk for people who live around the El Cerrito Hillside Natural Area. I expect that most of them don't own binoculars, so I will be concentrating on teaching them how to recognize the common birds by ear. It should be interesting. Others are welcome to come. If you are interested, let me know.
Key Words
birds,
El Cerrito Hillside Natural Area,
teaching
Thursday, January 24, 2008
Life. Life. What is it?
Biology is often described as the scientific study of life. Which is a pretty good definition, so long as you understand the biological definition of life. What is the biological definition of life? Well, I'm not sure there is one. We are pretty sure humans are alive, as are our individual cells. Plants, fungi, bacteria, these we know are alive. They have cells bounded by membranes. They have genetic material. They grow and reproduce. They exchange gasses with their environment and maintain their internal order by taking in low entropy material and putting out high entropy material.
In high school biology, I was told that viruses are not alive. They are like pieces of paper that say "Photocopy me!" They cause themselves to be replicated, but they don't actually self replicate. They don't grow. They don't exchange gasses. They don't take in low entropy material and put out high entropy material. They don't have a membrane.
Prions, misfolded proteins which cause other similar proteins to misfold in the same way, are even further from the traditional definition than are viruses. Viruses at least have their own genetic material. Prions don't. Therefore, not alive.
But we must be careful about phenomenological definitions. If we define Zebra as "an equid with stripes" then we can make any horse into a zebra by painting stripes on it, and an albino foal born to a zebra mother and zebra father would not a zebra. But an albino zebra is a zebra, and so while stripes are a prominent characteristic of zebrasity they are not a defining one.
So we must be wary of defining things in ways that they have to have some arbitrarily chosen us-like characteristic to qualify. Anthropocentrism is so uncool, and so limiting. Why does life need to have cells bounded by membranes? When earth is invaded by aliens who's tissues don't consist of cells bounded by membranes, are we going to insist that they aren't alive? I hope not. If on Mars we find some manner of critter that self replicates, exchanges gases and takes in low entropy matter/energy in order to maintain a low internal entropy state, but is without genetic material, are we going to say, "damn, we thought we might have life here, too bad?" No. We would say how amazing yet expectable it was that Martian life does it differently than we do.
So I don't quite know what life is, but looking again at that list from my high school biology class, there are certain criteria that make more sense than others. The "cells bounded by membranes" criterion is foolish, based only on the fact that we have only ever observed one related group of living things. It is like defining humans as light skinned after a visit to one family in Norway. The "has genetic material" criterion makes a bit more sense. I would rephrase it as "makes offspring that are more similar to themselves than would be expected randomly." The "grow and reproduce" thing is really two criteria. Growth, I think, is like the zebra's stripes. If we found beings that were built at full size by their parents, and then went on to make offspring that at the beginning of their lives were also full sized, but had high alivitude in every other way, I think we would recognize them as alive. Reproduction, on the other hand, seems a necessary component of a living system. Individuals who don't reproduce can be alive, but it is difficult to imagine a system in which life persists without reproduction. The "exchange gasses with their environment" malarkey is pure chauvinism. Most living things we know do, but is this a defining characteristic? No. "Maintains internal order by taking in low entropy mass/energy and putting out high entropy mass/entropy" is I think, inescapable for any lifeform.
So biology is (maybe) the study of entities or phenomena which make offspring that are more similar to themselves than would be expected randomly (in other words reproduce) and maintains internal order by taking in low entropy mass/energy and putting out high entropy mass/entropy. I'll have to think about this definition and see if I can think of counter-examples.
In high school biology, I was told that viruses are not alive. They are like pieces of paper that say "Photocopy me!" They cause themselves to be replicated, but they don't actually self replicate. They don't grow. They don't exchange gasses. They don't take in low entropy material and put out high entropy material. They don't have a membrane.
Prions, misfolded proteins which cause other similar proteins to misfold in the same way, are even further from the traditional definition than are viruses. Viruses at least have their own genetic material. Prions don't. Therefore, not alive.
But we must be careful about phenomenological definitions. If we define Zebra as "an equid with stripes" then we can make any horse into a zebra by painting stripes on it, and an albino foal born to a zebra mother and zebra father would not a zebra. But an albino zebra is a zebra, and so while stripes are a prominent characteristic of zebrasity they are not a defining one.
So we must be wary of defining things in ways that they have to have some arbitrarily chosen us-like characteristic to qualify. Anthropocentrism is so uncool, and so limiting. Why does life need to have cells bounded by membranes? When earth is invaded by aliens who's tissues don't consist of cells bounded by membranes, are we going to insist that they aren't alive? I hope not. If on Mars we find some manner of critter that self replicates, exchanges gases and takes in low entropy matter/energy in order to maintain a low internal entropy state, but is without genetic material, are we going to say, "damn, we thought we might have life here, too bad?" No. We would say how amazing yet expectable it was that Martian life does it differently than we do.
So I don't quite know what life is, but looking again at that list from my high school biology class, there are certain criteria that make more sense than others. The "cells bounded by membranes" criterion is foolish, based only on the fact that we have only ever observed one related group of living things. It is like defining humans as light skinned after a visit to one family in Norway. The "has genetic material" criterion makes a bit more sense. I would rephrase it as "makes offspring that are more similar to themselves than would be expected randomly." The "grow and reproduce" thing is really two criteria. Growth, I think, is like the zebra's stripes. If we found beings that were built at full size by their parents, and then went on to make offspring that at the beginning of their lives were also full sized, but had high alivitude in every other way, I think we would recognize them as alive. Reproduction, on the other hand, seems a necessary component of a living system. Individuals who don't reproduce can be alive, but it is difficult to imagine a system in which life persists without reproduction. The "exchange gasses with their environment" malarkey is pure chauvinism. Most living things we know do, but is this a defining characteristic? No. "Maintains internal order by taking in low entropy mass/energy and putting out high entropy mass/entropy" is I think, inescapable for any lifeform.
So biology is (maybe) the study of entities or phenomena which make offspring that are more similar to themselves than would be expected randomly (in other words reproduce) and maintains internal order by taking in low entropy mass/energy and putting out high entropy mass/entropy. I'll have to think about this definition and see if I can think of counter-examples.
Key Words
biology,
definitions,
life,
xenobiology,
zebra
Thursday, January 17, 2008
Origin of my genetic ponderings
As often happens with me, the harder I work on one thing, the more I get really interested in some completely unrelated distraction. My CTIX colleague Robert Horton refers to this as "dynamic shirking".
However, there were a few starting points. First, I have been noticing all the wonderful similarities and differences between my two daughters, and how they compare to Nissa and I. Besides the straightforward one-to-one inheritance of features (who's nose does she have), I was noticing some of what appeared to me to be quantitative variation (although I have not actually measured anything). This first hand experience got me thinking,"How does this whole inheritance thing really work?"
I realized that there were some very fundamental things I didn't have answers for.
Also I was reading through your Glossary post recently, and that got me thinking too.
However, there were a few starting points. First, I have been noticing all the wonderful similarities and differences between my two daughters, and how they compare to Nissa and I. Besides the straightforward one-to-one inheritance of features (who's nose does she have), I was noticing some of what appeared to me to be quantitative variation (although I have not actually measured anything). This first hand experience got me thinking,"How does this whole inheritance thing really work?"
I realized that there were some very fundamental things I didn't have answers for.
Also I was reading through your Glossary post recently, and that got me thinking too.
Tuesday, January 15, 2008
Numeric encoding in DNA
Stephen-
That is another question that is somewhat outside my area of knowledge, but I can tell you what I know. Number can be encoded in DNA in several ways. The most basic is that different individuals can have different numbers of copies of the same gene. Our chromosomes have lots of stretches of DNA that have been duplicated, sometimes many times. Something in the DNA replication process screws up, and you end up repeating a section of the chromosome, like a record skipping while you are making a copy of it. So if I have 2 copies of a gene, and you have 12, that is numeric information. Similar, but not necessarily to the point, are tandem repeats such as microsatellites. This is basically a stutter in (usually non-coding) DNA. A section of chromosome might have ATCATCATCATCATCATCATCATC so that is eight repeats. The other chromosome in the same person could have twelve repeats, and someone else could have 23. These things seem to combine a high mutation rate with very little selective pressure, meaning that they can evolve relatively randomly and very quickly, meaning they are very diverse within a population. For that reason they are often used for genealogical reconstructions and such.
Not exactly numeric, but not binary, is gene expression modulation. Genes are not necessarily just "on" or "off." A wide range of factors can turn up or down the expression a particular gene, including the particulars of the interactions of non-coding DNA in the promoter region at the beginning of that gene with the various promoter or repressers , which can themselves vary in concentration and structure. So the production from a gene is not 0 or 1 but rather can vary continuously from 0 to 1.
On the subject of telomeres, what their length determines is the number of times a cell can divide before its line dies out. This does not so much encode longevity, as take a part in determining the tradeoff between ability to heal and cancer risk. The body has many mechanisms that limit the ability of cells to divide rapidly, which reduces the risk of cancers (which are defined in part by their unchecked cell division)
but also limits healing (which requires cell division). Telomeres are one such mechanism. It is important to keep in mind though that there are enzymes that can extend telomeres, even in adult organisms, and most organisms have telomeres that are much longer than is needed for most of their cell lines to continue dividing throughout their lifetimes, and therefore telomeres are not in any meaningful sense coding for longevity.
I am sure there are other mechanisms of numeric encoding in genetic material, but I don't know what they are.
In response to your question about averaging of parental values, I would say this generally does not happen. For highly heritable traits, the mean value of the offspring should be similar to the mean value of the parents, but it is not the case that every individual offspring will be at or near that mean value. This is a point that is actually extremely important. During Darwin's time, there was a Scottish biologist whose name I can't remember now, who showed mathematically that if offspring get the mean value of their parents, Darwinian evolution does not work very well (effectively because variation is constantly being eliminated). Darwin was stumped for at least a while, until it was pointed out that each offspring does not get that mean value, but rather some value in a range centered on that mean. As an example, my brother is taller than either of my parents (even adjusting for sex) I am about the same height as my parents (again adjusting for sex) and my sister is (again adjusting) shorter than either of my parents.
So I am curious why you are asking all these questions about quantitative genetics. I assume you have had some idea for which genetics is a good analogy?
-Dan
That is another question that is somewhat outside my area of knowledge, but I can tell you what I know. Number can be encoded in DNA in several ways. The most basic is that different individuals can have different numbers of copies of the same gene. Our chromosomes have lots of stretches of DNA that have been duplicated, sometimes many times. Something in the DNA replication process screws up, and you end up repeating a section of the chromosome, like a record skipping while you are making a copy of it. So if I have 2 copies of a gene, and you have 12, that is numeric information. Similar, but not necessarily to the point, are tandem repeats such as microsatellites. This is basically a stutter in (usually non-coding) DNA. A section of chromosome might have ATCATCATCATCATCATCATCATC so that is eight repeats. The other chromosome in the same person could have twelve repeats, and someone else could have 23. These things seem to combine a high mutation rate with very little selective pressure, meaning that they can evolve relatively randomly and very quickly, meaning they are very diverse within a population. For that reason they are often used for genealogical reconstructions and such.
Not exactly numeric, but not binary, is gene expression modulation. Genes are not necessarily just "on" or "off." A wide range of factors can turn up or down the expression a particular gene, including the particulars of the interactions of non-coding DNA in the promoter region at the beginning of that gene with the various promoter or repressers , which can themselves vary in concentration and structure. So the production from a gene is not 0 or 1 but rather can vary continuously from 0 to 1.
On the subject of telomeres, what their length determines is the number of times a cell can divide before its line dies out. This does not so much encode longevity, as take a part in determining the tradeoff between ability to heal and cancer risk. The body has many mechanisms that limit the ability of cells to divide rapidly, which reduces the risk of cancers (which are defined in part by their unchecked cell division)
but also limits healing (which requires cell division). Telomeres are one such mechanism. It is important to keep in mind though that there are enzymes that can extend telomeres, even in adult organisms, and most organisms have telomeres that are much longer than is needed for most of their cell lines to continue dividing throughout their lifetimes, and therefore telomeres are not in any meaningful sense coding for longevity.
I am sure there are other mechanisms of numeric encoding in genetic material, but I don't know what they are.
In response to your question about averaging of parental values, I would say this generally does not happen. For highly heritable traits, the mean value of the offspring should be similar to the mean value of the parents, but it is not the case that every individual offspring will be at or near that mean value. This is a point that is actually extremely important. During Darwin's time, there was a Scottish biologist whose name I can't remember now, who showed mathematically that if offspring get the mean value of their parents, Darwinian evolution does not work very well (effectively because variation is constantly being eliminated). Darwin was stumped for at least a while, until it was pointed out that each offspring does not get that mean value, but rather some value in a range centered on that mean. As an example, my brother is taller than either of my parents (even adjusting for sex) I am about the same height as my parents (again adjusting for sex) and my sister is (again adjusting) shorter than either of my parents.
So I am curious why you are asking all these questions about quantitative genetics. I assume you have had some idea for which genetics is a good analogy?
-Dan
Key Words
demography,
genetics,
quantitative genetics,
telomeres
Numeric encoding in DNA?
What about the possibility that a single section of DNA could directly encode a number, rather than that number be only indirectly determined through the outcome of a multi-step process, specified by multiple genes? (which I agree is the norm)
The only example that I am aware of like this is the telemeres at the end of DNA strands. However, although they do directly quantify the number of times the DNA can be replicated as encoded in their length, the resulting trait of lifespan is obviously affected by many other factors.
Is it possible that some other regulatory genetic sequences operate like this, encoding a number in the length of the sequence?
All in all, I agree with your description of how resulting physical traits take on a continuous spread of values through a mixture of accident and complexity. And in the absence of enviromental differences, each trait is determined from the DNA through a process that can be unique to that subsystem that exhibits it. So in that sense, there are a dense jungle of different types of pathways that map the DNA to the numeric values of our traits.
I also gather from your description that most of the information in the network of genes that help to determine a trait, is ultimately stored in binary form. With a sufficient number of these genetic bits, a continuum of values can be well approximated. It is just how that information maps into a trait, which is what varies from system to system.
It is interesting that despite this complexity, it often is the case that certain traits in an offspring can end up being what appears to be a simple weighted average of the traits of the parents. When you think about though, the genetic reshuffling that occurs as parents' DNA merge, does not allow anthing like an operation of "taking the average". Fundamentally inheritance is boolean and alleles are either passed on or not.
On the other hand...
Hypothetically, if you did have "numeric" genetic sequences, averaging of the values might take the form of a new kind of dominance relationship between the pair of alleles. If they were neutrally dominant, half the time one value would be used, and the other half the time a different value would be expressed. This could result in a fluctuating production level of a hormone which over a short time would average out to the midpoint of the parents' values. Of course, in another situation this could result in the left arm being several inches longer than the right.
It is fun to kick these ideas around a bit.
- Stephen
The only example that I am aware of like this is the telemeres at the end of DNA strands. However, although they do directly quantify the number of times the DNA can be replicated as encoded in their length, the resulting trait of lifespan is obviously affected by many other factors.
Is it possible that some other regulatory genetic sequences operate like this, encoding a number in the length of the sequence?
All in all, I agree with your description of how resulting physical traits take on a continuous spread of values through a mixture of accident and complexity. And in the absence of enviromental differences, each trait is determined from the DNA through a process that can be unique to that subsystem that exhibits it. So in that sense, there are a dense jungle of different types of pathways that map the DNA to the numeric values of our traits.
I also gather from your description that most of the information in the network of genes that help to determine a trait, is ultimately stored in binary form. With a sufficient number of these genetic bits, a continuum of values can be well approximated. It is just how that information maps into a trait, which is what varies from system to system.
It is interesting that despite this complexity, it often is the case that certain traits in an offspring can end up being what appears to be a simple weighted average of the traits of the parents. When you think about though, the genetic reshuffling that occurs as parents' DNA merge, does not allow anthing like an operation of "taking the average". Fundamentally inheritance is boolean and alleles are either passed on or not.
On the other hand...
Hypothetically, if you did have "numeric" genetic sequences, averaging of the values might take the form of a new kind of dominance relationship between the pair of alleles. If they were neutrally dominant, half the time one value would be used, and the other half the time a different value would be expressed. This could result in a fluctuating production level of a hormone which over a short time would average out to the midpoint of the parents' values. Of course, in another situation this could result in the left arm being several inches longer than the right.
It is fun to kick these ideas around a bit.
- Stephen
Monday, January 14, 2008
Genetic Answer for Stephen: How and why traits vary continuously
Stephen-
There are several factors that can contribute to continuously varying traits, and we have to be careful not to conflate them. They are often divided into two broad categories, genetic factors and environmental factors, although there are often non-linear interactions between these.
On the genetic side, traits come in several flavors. The two state trait, where either you have it or you don't, is the classical Mendelian trait. Peas in a particualr population are white or green. If you have two alleles for green, or one for green and one for white, you make green peas. If you have no alleles that code for the green pigment, you make white peas. Next, as you described, are the three state genetic traits. Still all coded for at one locus, but dosage dependent, you end up with 0 or .5 or 1 full dose of the gene product. This is called incomplete dominance.
Then you get into additive multi-gene traits. Many different genetic loci have can affect human height, as an example. There was one gene, who's name I don't remember, that was recently shown to exhibit incomplete dominance in affecting human height. AA individuals are on average 5mm taller than the background population, Aa individuals are, on average, no different from the background population, and aa individuals are on average 5mm shorter than the mean of the population. But obviously height in humans varies by more than 1cm, so their must be other factors contributing. Some of these factors are genes affecting the length or shape of individual bones. Of those, some are classically dominant, some are incompletely dominant, and some may even be overdominant (where the Bb individual would have a longer bone than the BB or the bb). When you add together the variation in all these genes, you have a huge range of possible combinations, and end up with data that look pretty continuous. But then it gets even more complicated.
Genetic effects are not always additive. Imagine one gene codes for the presence a knob on a bone, and another gene causes that knob to be long or short. If an individual has the allele that causes that knob not to exist, it doesn't matter whether or not it has the allele that would make that knob long. If the knob isn't there, it can't be long. This is called epistasis. The sole effect of many genes, on a molecular level, is to regulate the activity of other genes. One gene makes a protein that carves up the protein product of a second gene, preventing that second protein from binding to a particular point on a chromosome where it would keep a third gene from being transcribed. Raise the temperature slightly, and the first protein changes conformation, and lets the second protein be, which cuts off production of the thrid gene. But if the Sodium concentration in the cell is too high, the third gene will be turned off anyway, because the excess sodium prevents the change in conformation of the first protein. People have mapped out enourmous cascades of gene effects with many branches, feedback loops, multiple environmental and epigentic modifiers and so forth. Just about every gene is pleiotropic, meaning that is has more than one effect. Similarly, almost every gene has multiple things that determine when, where, and how strongly it is expressed. Genes can also have synergistic interactions, competitive interactions, and so on.
So the genetics allow for a large number of possibilities, meaning that even purely genetic traits can vary close to continuously. But very few traits are purely genetic. Human height certainly isn't. The nutritional state of your mother before and during her pregnancy has an effect on your height. So does your own nutrition during the time you are growing. My grandfathers, who were cold and hungry through much of their childhoods, were shorter than any of their male grandchildren. My grandmothers, similarly, were shorter than any of their granddaughters. We, and our parents, ate better, so we grew more. Most Americans are taller than their grandparents were, not because of any genetic change, but because our environment is different than theirs was.
Once again, there are non-linear interactions, both between environmental effects, and between environment and genes. In some cases organisms seem to be genetically programmed to let the environment have a very strong effect on their development. I won't go into detail because I think you get the picture. We are vastly complex systems, and their is ample opportunity for feedback, interference, competition and so forth. And given the number of inputs, and the complexity of the algorithm, continuous outputs are nearly inevitable. Even classical Mendelian traits are rarely all that discrete in their distribution if one allows environment to vary and does not have an inbred population.
As for growth thresholds, what tells a bone to stop getting longer now, and start growing internally instead, I know very little. The molecular basis of development is a very active field of research, but is far enough from my own that I haven't paid much attention to it.
Have I answered your question?
-Dan
There are several factors that can contribute to continuously varying traits, and we have to be careful not to conflate them. They are often divided into two broad categories, genetic factors and environmental factors, although there are often non-linear interactions between these.
On the genetic side, traits come in several flavors. The two state trait, where either you have it or you don't, is the classical Mendelian trait. Peas in a particualr population are white or green. If you have two alleles for green, or one for green and one for white, you make green peas. If you have no alleles that code for the green pigment, you make white peas. Next, as you described, are the three state genetic traits. Still all coded for at one locus, but dosage dependent, you end up with 0 or .5 or 1 full dose of the gene product. This is called incomplete dominance.
Then you get into additive multi-gene traits. Many different genetic loci have can affect human height, as an example. There was one gene, who's name I don't remember, that was recently shown to exhibit incomplete dominance in affecting human height. AA individuals are on average 5mm taller than the background population, Aa individuals are, on average, no different from the background population, and aa individuals are on average 5mm shorter than the mean of the population. But obviously height in humans varies by more than 1cm, so their must be other factors contributing. Some of these factors are genes affecting the length or shape of individual bones. Of those, some are classically dominant, some are incompletely dominant, and some may even be overdominant (where the Bb individual would have a longer bone than the BB or the bb). When you add together the variation in all these genes, you have a huge range of possible combinations, and end up with data that look pretty continuous. But then it gets even more complicated.
Genetic effects are not always additive. Imagine one gene codes for the presence a knob on a bone, and another gene causes that knob to be long or short. If an individual has the allele that causes that knob not to exist, it doesn't matter whether or not it has the allele that would make that knob long. If the knob isn't there, it can't be long. This is called epistasis. The sole effect of many genes, on a molecular level, is to regulate the activity of other genes. One gene makes a protein that carves up the protein product of a second gene, preventing that second protein from binding to a particular point on a chromosome where it would keep a third gene from being transcribed. Raise the temperature slightly, and the first protein changes conformation, and lets the second protein be, which cuts off production of the thrid gene. But if the Sodium concentration in the cell is too high, the third gene will be turned off anyway, because the excess sodium prevents the change in conformation of the first protein. People have mapped out enourmous cascades of gene effects with many branches, feedback loops, multiple environmental and epigentic modifiers and so forth. Just about every gene is pleiotropic, meaning that is has more than one effect. Similarly, almost every gene has multiple things that determine when, where, and how strongly it is expressed. Genes can also have synergistic interactions, competitive interactions, and so on.
So the genetics allow for a large number of possibilities, meaning that even purely genetic traits can vary close to continuously. But very few traits are purely genetic. Human height certainly isn't. The nutritional state of your mother before and during her pregnancy has an effect on your height. So does your own nutrition during the time you are growing. My grandfathers, who were cold and hungry through much of their childhoods, were shorter than any of their male grandchildren. My grandmothers, similarly, were shorter than any of their granddaughters. We, and our parents, ate better, so we grew more. Most Americans are taller than their grandparents were, not because of any genetic change, but because our environment is different than theirs was.
Once again, there are non-linear interactions, both between environmental effects, and between environment and genes. In some cases organisms seem to be genetically programmed to let the environment have a very strong effect on their development. I won't go into detail because I think you get the picture. We are vastly complex systems, and their is ample opportunity for feedback, interference, competition and so forth. And given the number of inputs, and the complexity of the algorithm, continuous outputs are nearly inevitable. Even classical Mendelian traits are rarely all that discrete in their distribution if one allows environment to vary and does not have an inbred population.
As for growth thresholds, what tells a bone to stop getting longer now, and start growing internally instead, I know very little. The molecular basis of development is a very active field of research, but is far enough from my own that I haven't paid much attention to it.
Have I answered your question?
-Dan
Sunday, January 13, 2008
Genetic Question for Dan
What is the genetic mechanism that controls continuously variable traits (height, bone thickness, pigmentation, etc.) ? I am aware the very simple case in flowers where the presence of normal petal color is determined by two copies of a gene, each of which produce a certain enzyme. A flower can have either zero, one or two copies of this gene, which results in a net production of the pigment enzyme in corresponding amounts of zero, about half-normal, or full-normal. The resulting flower color is then either pure white when there is no enzyme, whiteish-purple for medium enzyme levels, or deep purple when enzyme levels are fully normal. In principle, this is really a three-state set of trait values {0, 1/2, 1}. Although it is possible that environmental factors might cause the ½ level of enzyme to vary between individual flowers, resulting in a smearing out of the medium state in color space, such that the distribution of trait values appears to be a bit more continuous in the population
Is multi-gene encoding of enzyme/hormone levels the only way that continuously variable traits are controlled? What about genes being turned on and off? A single gene turns on and starts producing a certain growth hormone. The creature keeps growing until a certain condition is met, at which point the gene turns off, the hormone levels dwindle, and the creature’s shoe size has reached its maximum value. However, although only one gene encoded the recipe for the growth hormone, there must have been something else that prescribed the “turn off” condition, and that would be what is really responsible for the creature’s terminal value of shoe size. Different individuals with different shoe sizes would have identical growth hormone genes, but would have variation in the genes that encoded their shoe size via this “stop making hormone, my feet are big enough” mechanism. Unfortunately, we are right back to the fundamental question of how is a continuous numeric quantity is encoded by a set of genes. In this example, we would need to understand how the “hormone turn off” mechanism worked, and what knob in this mechanism could be continuously controlled via variation in some set of genes.
When you think about it, just about every little detail in an organism must have some sort of a control like this, since the length, curvature, and density of bones, muscles, organs, are all continuously variable during the growth of the organism. The final shape of each piece must be determined by possibly hundreds of specific dimensions and continuous quantities. How much is currently known about the mechanisms for encoding this information in our genome? If there are any serious flaws in my reasoning, or biological basics, please let me know, as I am very curious to understand this better.
Thanks
- Stephen
Is multi-gene encoding of enzyme/hormone levels the only way that continuously variable traits are controlled? What about genes being turned on and off? A single gene turns on and starts producing a certain growth hormone. The creature keeps growing until a certain condition is met, at which point the gene turns off, the hormone levels dwindle, and the creature’s shoe size has reached its maximum value. However, although only one gene encoded the recipe for the growth hormone, there must have been something else that prescribed the “turn off” condition, and that would be what is really responsible for the creature’s terminal value of shoe size. Different individuals with different shoe sizes would have identical growth hormone genes, but would have variation in the genes that encoded their shoe size via this “stop making hormone, my feet are big enough” mechanism. Unfortunately, we are right back to the fundamental question of how is a continuous numeric quantity is encoded by a set of genes. In this example, we would need to understand how the “hormone turn off” mechanism worked, and what knob in this mechanism could be continuously controlled via variation in some set of genes.
When you think about it, just about every little detail in an organism must have some sort of a control like this, since the length, curvature, and density of bones, muscles, organs, are all continuously variable during the growth of the organism. The final shape of each piece must be determined by possibly hundreds of specific dimensions and continuous quantities. How much is currently known about the mechanisms for encoding this information in our genome? If there are any serious flaws in my reasoning, or biological basics, please let me know, as I am very curious to understand this better.
Thanks
- Stephen
Key Words
genetics,
incomplete dominance,
quantitative genetics
Wednesday, January 09, 2008
El Cerrito Hillside Natural Area, January list
I've decided to have one post per month for this list, and add things to the existing list as I see them. Here is the January list. 44 species are listed at present.
Birds:
Western Scrub-Jay
Stellar's Jay
American Crow
Northern Raven
added Jan 15th: Hutton's Vireo
Black Phoebe
Yellow-rumped Warblers
added Jan 15th: Townsend's Warbler
Bewick's Wren
Chestnut-backed Chickadee
added Jan 22nd: Oak Titmouse
House Sparrow
Ruby-Crowned Kinglet
Golden-Crowned Kinglet
American Robin
Bush Tit
Hermit Thrush
Northern Mockingbird
White-crowned Sparrow
Golden-crowned Sparrow
added Jan 15th: Song Sparrow
Spotted Towhee
California Towhee
Dark-eyed Junco
Cedar Waxwing
American Goldfinch
added Jan 14th: Lesser Goldfinch
House Finch
Cooper's Hawk
Red Tailed Hawk
American Kestrel
Great Horned Owl
Red-breasted Nuthatch
Downy Woodpecker
Red-shafted Flicker
Red-breasted Sapsucker
added Jan 15th: Nuttall's Woodpecker
Anna's Hummingbird
Turkey Vulture
American Coot
added Jan. 27th Double-crested Cormorant
Rock Pigeon
Mourning Dove
Mammals:
Eastern Fox Squirrel (Sciurus niger)
Mule Dear (Odocoileus hemionus)
Voles (Microtus californicus? runways and burrows)
Pocket Gophers (burrows)
Fox (Grey fox? scat)
Skunk (smelled, species?)
Herps:
Southern Alligator Lizard (Elgaria multicarinata)
California Slender Salamander (Batrachoseps attenuatus)
Birds:
Western Scrub-Jay
Stellar's Jay
American Crow
Northern Raven
added Jan 15th: Hutton's Vireo
Black Phoebe
Yellow-rumped Warblers
added Jan 15th: Townsend's Warbler
Bewick's Wren
Chestnut-backed Chickadee
added Jan 22nd: Oak Titmouse
House Sparrow
Ruby-Crowned Kinglet
Golden-Crowned Kinglet
American Robin
Bush Tit
Hermit Thrush
Northern Mockingbird
White-crowned Sparrow
Golden-crowned Sparrow
added Jan 15th: Song Sparrow
Spotted Towhee
California Towhee
Dark-eyed Junco
Cedar Waxwing
American Goldfinch
added Jan 14th: Lesser Goldfinch
House Finch
Cooper's Hawk
Red Tailed Hawk
American Kestrel
Great Horned Owl
Red-breasted Nuthatch
Downy Woodpecker
Red-shafted Flicker
Red-breasted Sapsucker
added Jan 15th: Nuttall's Woodpecker
Anna's Hummingbird
Turkey Vulture
American Coot
added Jan. 27th Double-crested Cormorant
Rock Pigeon
Mourning Dove
Mammals:
Eastern Fox Squirrel (Sciurus niger)
Mule Dear (Odocoileus hemionus)
Voles (Microtus californicus? runways and burrows)
Pocket Gophers (burrows)
Fox (Grey fox? scat)
Skunk (smelled, species?)
Herps:
Southern Alligator Lizard (Elgaria multicarinata)
California Slender Salamander (Batrachoseps attenuatus)
Key Words
birds,
El Cerrito Hillside Natural Area,
Natural History
Friday, January 04, 2008
Glossary of Behavior
A1 & A2 receptors-Auditory receptors found in moth ears (which are located on the side of the thorax). A1 receptors are 10x more sensitive than A2 receptors, and picks up ultrasounds at low to moderate intensity (when the bat, its predator, is further away). When a bat is within 120 feet, the A1 receptor picks up the sound, and depending whether it came from the left or right side, the moth flies in the direction away from the sound. It is able to detect this because the sound will hit the A1 receptor on one side slightly before it _hits the other, which is partially shielded by the moth's body. When the bat is within 20 feet, the A2 receptor causes a motor response where the moth displays erratic flight behavior with free loops and dives. More Detail: Moth can tell whether the bat is above it due to fluctuation of A1 receptor firing that is caused by the shielding and unshielding of the moth wings. When the bat is below the moth, there's no fluctuation. When the moth is less than 3 meters away from the bat, there's no time for it to escape detection, so it initiate evasive maneuvers. They would dive into a bush or grassy spot that would mask the moth (bat's echo bounce off the grasses and shrubbery). The moth's erratic flight behavior happens when A2 is stimulated (by high intensity) -> brain -> shuts down flight motor neurons -> no steering mechanism -> eratic flight pattern
Actogram: Activity plot that records an individual's activity/rhythmicity in a given time period. used to study circadian rhythm example given in class: baby's sleep-wake pattern from day to day becomes increasingly consistent with age as circadian rhythm is established, shown by the actogram that exhibits increasingly similar activity patterns in 24hr cycles
Action Potential(lecture 11/21): A rapid change between the negative and positive ion charges within an axon. Action potentials carry information from neuron to neuron. How an action potential occurs: when a neuron is at rest, it has a net negative charge inside of the cell (resting potential = appr. -70 mV). Once a neuron gets stimulated above a certain threshold membrane potential voltage (normally some voltage more positive then the resting state) the Na+ channels open and lots of Na+ flood into the cell making the inside of neuron more positive relative to the outside (depolarization). After the action potential reaches a peak positive voltage of appr. 50 mV, the Na+ channels close and K+ channels open so that a bunch of K+ flood out of the cell (repolarization = "falling phase"). Normally when the K+ ions flood out, they undershoot the resting state or make the membrane potential of the neuron more negative than at the resting state (hyperpolarization). The K+ channels close after this undershoot, then both Na+ and K+ turn on to restore the neuron to its resting state membrane potential (refractory period). Note: it is not the actual movement of ions in or out that create a positive or negative membrane potential but the relative concentration of ions inside and outside the neuron.
Adaptive- conferring a positive fitness relative to competing traits, in the current environment.
Aggression- A subset of agonistic behavior - When an organism intends (in the sense that natural selection has dictated so in a given set of circumstances) to inflict some action against another animal that leads to a direct cost. 7 types of aggression: (studied in baboons)
- Spacing: territory, function is to control resources and provide for sufficient nutrients over long time
- Dominance: where one animal through experience maintain dominance over another individual, has to do with controlling resources (have to specify what the resource is because dominance order can vary from situation to situation; imply linear hierarchy but can be non-linear)
- Sexual: obtain mates, or situation where aggression is used to subdue potential mates and force them into copulations (female tests male's ability to subdue her)
- Parental: discipline, maintaining order, and training young. (ex. is enforced dispersal when young grows, getting them to leave the troop)
- Weaning: parent-offspring conflict
- Anti predator: "life dinner" principle - if you're a prey, you're willing to do anything to stay alive, predators are g bird or human. Closed-ended song bird learner has one period in life when they can learn songs. They have an earlsubdued in their attempts to kill a prey (rabbit risks life, wolf risks dinner)
- Moralistic: enforce conformity and peace
*not all animals exhibit all 7 types of aggression.
Agonistic behavior-acting with the intent to restrict the freedom or fitness of another animal; includes aggression.
Ethology definition of agonistic behavior from Dictionary.com… "pertaining to the range of activities associated with aggressive encounters between members of the same species, including threat, attack, appeasement, or retreat."
Altricial : describes species whose newly hatched or born young are relatively immobile and helpless. They require a great deal of care by parents. Many species of birds and mammals have altricial young. The opposite of precocial young.
American Cockroaches : A cockroach can turn and run away at 70-80cm/s to escape a predator. The escape behavior is initiated by a pair of very sensitive hairs at the end of the abdomen. The hair is called cercus (plural is cerci), and it can detect changes in the air pressure around the abdomen and elicit running as soon as in 8.2ms after a puff of air. A parasitiod wasp, Ampulex compressa (emerald cockroach wasp), can sting a cockroach on the subesophageal ganglion, thereby paralyzing it but keeping it alive to lay eggs on. When the eggs hatch the larvae eat the roach alive. Here is an article about zombie cockroaches..
http://www.newscientist.com/article/dn12983-zombie-cockroaches-revived-by-brain-shot.html
http://www.newscientist.com/article/dn12983-zombie-cockroaches-revived-by-brain-shot.html
Anole Lizards- (lecture 10/24) An example of territoriality where lizards that are similar in size tend to be more territorial. This is because similar sized animals are more likely to go after prey that is the same size. If the lizards are different sizes, one big/one small, they will probably be less territorial because they will not be in competition over the same food.
Arms race-the never-ending evolutionary competition between the linages of a sender and a receiver of a signal. Ultimately the receiver has the upper hand in the arms race, driving selection on the sender's signal. An example would be the waxbill and the whydah. Complex gape markings have evolved in the waxbill to prevent brood parasitism by the whydah. As the gape markings have evolved to become more complex in the waxbill, so too have those in the whydah. The two birds are in a constant arms race.
Associative Learning - A learning process where animals associate one stimulus with an outcome. An example of associative learning is where a dog learns that the sound of a bell means that food will be presented shortly. In other words, the dog associates the sound of the bell to the time of being fed. (11/19) Types of associative learning include classical conditioning, as experimented by Pavlov.
Axon-Process extending from neuron cell body; conducts action potentials away from cell body. Often covered by myelin sheath with gaps, called Nodes of Ranvier, that allow for faster conduction of the action potential through saltation. Schwann Cells insulate the axon and greatly increase the speed of the action potential.
Behavioral Contexts for Communication:
- Conflict resolution (agnostic signals) - help increase fitness, ex. antelope fight.
- Territorial defense (territorial signals).
- Sexual interactions (male attraction signals) - males in most species have more diverse signals.
- Parent-offspring interaction - ex. begging in birds.
- Predator-prey interactions - ex. alarm signals.
- Social integration (affiliative signals) - when individuals try to join groups.
Behavioral Genetics- The study of how genes and gene expression affect behavior.
Biological Clock: An internal physiological mechanism that enables organisms to time any of a wide assortment of biological processes and activities.
Biological Rhythms-Allow change of behavior to meet demands of changing environment (e.g. night versus day).
Brood parasitism : The exploitation of honest signaling by an individual of a different species (interspecific parasitism) or the same species (intraspecific parasitism) on a nest of another individual (host), such that the "parasite" gains resources intended for the young of the "host" by mimicking feeding behavior. For example, the cowbirds (parasite) and junco (host). Cowbirds lack parental care, so they enter the nests of cuckoos, whose brightly-colored gaping mouths signal their mother to deliver food into them. Because cowbirds have redder mouths and are bigger than their nest-mates, they generally monopolize the feeds and grow bigger than the juncos. Brood parasitism can be escaped via the communications arms race.
Central Pattern Generator: Endogenously (meaning without outside stimulation) produced motor output that is caused by neurons firing in a fixed rhythm. Can be set up in a linear, circular or network pattern. allows for patterned behavior (ex. breathing, walking, etc) examples inlcude locust flight (CPG responsible for movement of depressor and elevator muscles used during flight) and midshipmen fish ( CPG controls muscles around swim bladder to produce "song") and the fixed action pattern goose example (goose continuing the rolling motion to collect a lost egg even if the egg is experimentally removed the motion must still be completed).
Changes in Morphology: change in behavior may result from change in non-neural morphology. An example of this are paddlefish where young feed on individual food items and adults filter feed indiscriminately, dependent on development of gill rakers
Chemosensory: relating to the perception of a chemical stimulus by sensory means. Used in taste and, especially, olfactory reception. Used in class as one of the four sensory modalities of communication (the other three being visual, tactile and auditory). Examples from class for chemosensory communication included moth pheromones and scents given off by predatory plants.
Circadian Rhythm: a roughly 24-hour cycle of behavior that expresses itself independent of environmental changes (circa dies = about the day). Circadian rhythms are ubiquitous in biology. Circadian rhythms evolved to protect DNA from UV damages; DNA thought to divide at night. *it is an endogenous clock, with about 24 hour cycle 1. Persists in constant conditions for at least 1 cycle 2. Reset clock with pulses of light/dark 3. Increased temp. has no effect on it
Circannual Rhythm: much like circadian rhythm that measures a 24 hour cycle, Circannual rhythm measures years. For example: some animals breed annually. When their internal clock sets every year, they breed. There is limited evidence that organisms have true circannual rhythms, not affected by factors like day length and light.
Classical Conditioning: a type of associative learning in which an animal learns to respond to an external stimulus which does not normally elicit a response. It unconsciously associates the stimulus with an unrelated reward or object. This eventually becomes an automatic response, as compared to operant learning the animal can chooses to act or not.
An example of Classical conditioning would be the Pavlov's dog. Whenever Pavlov present the meat to the dog, he would ring the bell. After repeating this procedure several times, the dog will salivate in response to the bell even when there was no meat present.
Closed-ended vs. open ended learners: Closed- ended learners can only learn a song during one period of time. Open-ended mock other birds and add to what they already know.
Communication - when a sender uses a specially evolved signal to modify the behavior of the receiver. True communication takes place only when the sender's fitness tends to increases based on the transfer of information. e.g. honesty (both R and S fitness increase) and deceit (S fitness increases while R fitness decreases).
Compass - One of the four mechanisms that animals use to travel over distances. The animal uses a certain object in the environment where it can reference itself to such as the sun or stars at night. Starlings use stars when they migrate during seasonal changes.
Concorde Fallacy-basing a decision on past invesment rather than future predicted cost(s) and benefits. Lecture 10/26 example = Dr. Caldwell’s study of the Dasoni and Sweti stomatopods. Dasoni make two minute burrows in soupy mud while Sweti make 2 hour burrows in sandy mud. The fallacy wou;d have been made if researchers thought that the Sweti were more aggressive in defending their burrows because of their past investment. However, it was actually the future cost of having to make another burrow that caused the Sweti to be more aggressive.
Cortical Magnification - The somatosensory cortex of an animal's brain devotes more neuronal area to important sensory areas, like the star-nosed mole's nose, than to less important ones. The disproportionate amount of brain area dedicated to input from specific regions is known as cortical magnification.
Cost/Benefit Plots (for signal intensity)- (covered in lecture 10/15 and a little 10/17) The y-axes of the plot is costs and benefits. The x-axis is signal intensity (as presented in Dustin's lectures). The BENEFITS curve was presented in lecture as logarithmic. Each individual organism has a COST line (given as linear in lecture) on the same plot whose slope depends on the quality of that individual. In general, a higher quality individual will be able to produce a given signal intensity at a lower cost than a lower quality male (high quality, shallow slope). The optimal signal intensity for a given individual is obtained by finding the line tangent to the BENEFITS curve that is parallel to that individual's COST line. This plot is used to show why it is costly for a lower quality male to send "dishonest" signals (ones that are higher than they can manage).
Crepuscular- This describes animals who are mostly active at dawn or dusk, as opposed to night activity (nocturnal) or day activity (diurnal).
Cue - an incidental information transfer from which the sender may or may not benefit. For example, a frog (sender) rustling (signal) in the grass may incidentally communicate its position to an owl (receiver) which would decrease the fitness of the sender and benefit the receiver.
Dawn Chorus: A phenomenon that occurs just before the sun rises, or shortly after, in which a succession of bird song begins. There is usually a specific order in which songbird species begin to sing, and it is not fully understood why songbirds participate in it. A few of the proposed (shaky) hypotheses are that females may be more fertile at dawn, sounds may travel better in the still air, there is nothing else to do (the insects aren't moving around yet), or it is used as an honest advertising strategy (the more you sing in the early morning, the healthier you are).
Dead Reckoning: (=Path Integration) one of the 4 mechanisms used by animals to find their way to a specific destination. The individual keeps track of movement and the direction changes taking place. The individual uses this mechanism to get back to the starting point. Two ways to interfere with dead reckoning is 1) overloading and 2) knocking out with anesthetic.
Needs three sub-mechanisms: *a) compass: to navigate turning. Some animals use polarization patterns in the sky will be recorded and tracked. *b) odometer: which tells it how far the animal has gone in a unit of time. Animals use the position of their body and position of their legs while moving. *c) information storage and integration to calculate and remember location based on compass and odometer.
An example of dead reckoning is: the desert ant. This lives in the sierra sands and usually forages very far away from the ant hill. Eventually finds a seed very far away and in a convoluted route. Miraculously the ants go back to their ant hill home in a straight line. This suggests that they truly use dead reckoning. Desert ants are particularly aggressive. If you expose an ant to an “alien” while its far away from its ant hill, it usually won’t fight back. But if you expose an ant to an “alien” while close to its ant hill (but not AT the ant hill) it will fight to the death. So it must know where home is and how far away it is from there.
An experiment of dead reckoning: take the ant and let it go out to find food away from ant hill. The researcher performs a manipulation. Take the ant and put it on stilts to extend the leg prosthetically. Ant then overshoots where his home is and goes too far. Can also amputate the legs so the ant is now running on short legs. Ants search for their home too early; undershoots where its home is. So the ants are actually counting their footsteps and how many steps they’ve taken away from their home. Ants are integrating the information and their brain is calculating all the twists and turns to determine where its original starting point (home) is.
Dear-Enemy Hypothesis(Lecture 10/24): One of the reasons why being territorial is an advantageous behavior. The argument is that by being territorial and by establishing known neighbors, the organism can reduce the amount of time and energy spent on territorial defense. Over time the neighbors learn to ignore each other as long as they do not cross onto each other's territory. Once the relationship is established between the neighbors, one neighbor is likely to help the other in a fight with an intruder when the neighbor is smaller than the helper and the intruder is larger than the neighbor.
Deceit - a form of communication in which the sender benefits his fitness but the receiver decreases its fitness. For example, the anglerfish (sender) flashes light (signal) in the dark ocean depths to attract prey (receiver)which are then eaten. Out of the four different forms of communication, it is one of the more common ones (as opposed to spite) and is most often seen in a situation predator/prey situation.
Dendrite(Lecture 11/21): A process off of a neuron that receives and integrates synaptic inputs from other neurons. After the dendrites receive the impulse, it is passed toward the soma, the body of the neuron, then on to the axon terminals.
Despotic Model(Lecture 10/26): A type of territoriality in which animals defend set sized territories, and territories do not shrink as population density increases. Eventually when reaches the capacity, no more space can be occupied for newcomer to establish territory.
Development(Lecture 11/2): A process of gene-environment interaction. Influence of environment may vary at different times. Other than the environment, behavioral change during development is mediated by the development of the nervous system, the endocrine system, and morphology.
Deprivation Studies: Chimp Study: (Lecture 11/2) Study done in the 40s, raised chimpanzees in complete darkness. Once the lights were turned on and the chimps were shown a milk bottle, they did not visually recognize it, but did recognize the touch of it. This proved that visual perception is learned.
Direct Fitness: The number of descendant individuals produced by an individual, times the degree of relatedness of those descendants to that individual.
Discontinuous traits: traits that can be inherited in a Mendelian fashion and occur as two or three distinct phenotypes, such as number of fingers, instead of as a continuum, as does for example height. These traits are generally due to dominance among two alleles and therefore are inherited in a mendelian fashion following the rules of independent assortment, etc. These traits can be used in inbred studies to determine heritability in the broad sense.
Dizygotic Twins: also referred as fraternal twins. 2 eggs are released at the same time; each fertilized by a sperm, which 7% of the time involves sperm from two different fathers. The relatedness between dizygotic twins are the same as full siblings , r=0.5, they just happen to develop in the same uterus simultaneously. The occurrence of dizygotic twins is actually heritable.
DNA Methylation: an epigenetic phenonmenon also known as gene silenceing. Results in the formation of different tissues and behaviours despite identical genetic code. This is how the environment influences the expression of the genes.
Dominance: one of the seven types of aggression; one animal will usually maintain the right of way over another individual; control resources more than one baboon, in one situation access to food A>B>C access different resource handling in fact may differ B>C>A dominance. 1) Specify contested resource, can very situation to situation and 2) Dominant hierarchy imply linear, since nonlinear not equal all linear. Also used in the genetic sense, and to signify that an individual or group is of higher social status than another.
Eavesdropping(exploitation): A subset of the communication matrix in which there is a cost to the sender who sent the signal, and a benefit to an outside "eavesdropper" who was not the intended reciever. Ex. A male frog sends a mating croak to a female frog, but a bat uses this mating signal to locate its prey, the male frog. Another Example: Male chickadees sing to define their territory. In the meantime, female chickadees listen in on the songs to select their mates.
Economic Defendability: optimality models primarily predict the occurrence of territoriality based on whether the net benefits of defense are greater than the net benefits of a non-aggressive strategy; that is whether the resource is economically defendable. This term was coined by Jerram Brown.
Endogenous Clocks: allow prediction of forthcoming conditions - example: exit burrow at correct times, migrate prior to winter, coordinate and synchronize physiological processes (like the sleep-waking rhythm, body temperature, but also our sensitivity to pain or alcohol, reaction time, levels of hormones in blood, etc)
Entrainment: Having a little bit of flexibility in a circadian rhythm. For example, an individual may have an endogenous cycle of 23.5 hrs (a little bit less than the 24-hr Circadian rhythm) or 24.5 hrs (a little bit more than the 24-hr Circadian rhythm). This animal's endogenous cycle is considered free-running when the individual is not affected by environmental cues. However, if the animal is sensitive to environmental cues such as a photoperiod, its free-running endogenous cycle can become entrained to the 24-hr Circadian rhythm of light and dark days. Thus, the animal would have a cycle that runs 24 hrs instead of 23.5 or 24.5 hrs. Once those environmental cues are taken away, or the animal is no longer sensitive to those environmental cues, the animal's endogenous cycle will be free-running again. Under constant conditions, this condition is free-running and has a circadian Rhythm just less than 24 hours a day, even though the onset time is approximately the same, each day it's a couple of minutes earlier. The light/dark cycle trains that rhythm, by resetting it. Allows for greater flexibility of our circadian rhythms. (Ex. changing amounts of daylight that result in migration)
Epigenesis: the process by which, at any point in ontogeny, current phenotype sets stage for further development guided by genes whose expression are more or less modified by environmental influences. eg, babies raised in different enviroment developed into different adults.
Epistasis: A genetic phenomenon in which certain alleles of one gene mask the effect of another gene.
Ethology-the discipline dedicated to the study of both the proximate and ultimate causes of animal behavior
Ethyl oleate: a chemical produced by honeybees to slow maturation; ex) slow transformation from nurse to forager.
Eusociality: a phenomenon where some members of the species are born sterile in order to carry out specific tasks, including taking care of the reproductive members. Eusociality is an extreme form of kin selection that occurs in haplo-diploid species like ants, bees, and wasps. It is also found in some very inbred populations, such as naked mole rats.
Evolution: Change in allele frequency of a population over time. Mechanisms by which evolution proceed are by: mutation, genetic drift, founder events, and most importantly natural selection.
Evolutionary Arms Race: A communication battle between receivers and signalers to maximize fitness through adaptation and evolution. Is also used in context outside of communication, such as a prey species evolving to be increasingly toxic, and a predator species evolving to be increasingly resistant to that toxin.
External Coincidence Model (ECM): proposed by Erwin Bunning in 1936 - there is a circadian rhythm or oscillation of photosensitivity. There is a small period where if light hits the organism, then the rhythm continues. This is the model behind skeleton photoperiods (see photoperiodism).
Fiddler Crabs-territoriality"wrinkle": Blackwell observed Fiddler crabs that lived in very high density and close proximity. Occasionally when an intruder crab attacked a resident, its neighbor would come into that resident's territory and help it defend against the intruder. They observed that this occurred when the resident under attack was small and the intruder was much larger. Thus if the victor were the larger male, it would have fitness implications for the neighbor crab in terms of expanding territory and acquiring mates. Therefore, the neighbor crab temporarily protects its own future fitness by helping its neighbor defend his territory.
Filial Imprinting - precocial species imprint on moving object (duck, goose, lamb), they are sensitive to conspicous, slow steady movements are favored, form of object, and the sound and/or odor.
Fine Tuning - The second part of the "selective attrition" phenomenon of young birds selecting their repetoir. After selecting songs that are close to his neighbors (during the plastic phase), the young bird will modify his songs to be slightly different from his neighbors during crystallization in order to keep his own identification.
Fitness- reproductive success; can be measured according to number of offspring an organism directly reproduces (direct fitness) or the number of its relatives' progeny that would not have survived without this organism's aid/efforts (indirect fitness)
Fire Ants: (example of discontinuous behavior/traits): There are 2 types of fire ants. The first carries the GP9 gene, which codes for recognition of other ants, and thus in a colony of type 1 fire ants, they only tolerate one queen. The second type carries a defective GP9 gene, and thus loses the recognition and can tolerate many queens (allowing the colony to expand very rapidly).
Fixed Action Pattern: a highly stereotyped innate behavior that is triggered by an external stimulus known as the sign stimulus or releaser. FAP's are species-typical and, once triggered by sign stimuli, will proceed even in the absence of the triggering stimulus. Once a FAP is started, it must be completed. The primary example is the graylag goose. If an egg falls out of the nest, the goose will reach out with its neck and roll the egg back in. However, when the egg is removed by experimenters in the middle of the rolling, the goose will still continue the action to completion. FAP's can be modified by experiences and the environment (e.g. sheepdog) and it is not always triggered in the presence of the external stimulus. FAP may also be found in humans. For example, Irenaeus Eibl-Eibesteldt and Hans Hass at the Max-Plank Institute for Behavioral Physiology in Germany worked with a Hindu woman and found that she was smiling from eyebrows. It was concluded that all cultures do this. There's criticism of the term FAP because behavior isn't as fixed as implied by the term. There are subtle variations between and within animals. For example, the duration of individual components that vary around a mean value.
Foraging (for) genes: Flies carry one of two types of the foraging gene; either the dominant for rover gene or the recessive for sitter gene. Larvae with the rover gene move around more than sitter larvae while feeding and they are also more likely to explore new food patches than sitters. In honeybees, young individuals do not express the for gene and stay close to the nest. As they mature, the increasingly express the for gene and become foragers, traveling far from the nest in search of food.
Foulbrood diseases: Disease found in honey bees where the honey bee larvae is infected by the rod-shape bacterium Paenibacillus. The bacteria grows and reproduces spores within the larvae which causes it to darken and die. Millions of spores spread from the dead larvae will infect other larvae in the hive. This lead to the discovery of uncapping and larvae dumping behavior in bees. Bee hives which uncap the infected larvae and dumps out the dead larvae has a higher chance of surviving.
Foxp2: gene associated with vocal learning.
Free-running periods: A cycle of activity not matched to environmental cues is called a free running cycle, and its length is called the period. The period often deviates slighty from the 24 hour cycle, but can be reset to match the 24 hour cycle via entrainment. slight drifts on a daily basis of the endogenous cycle (circadian rhythm). this flexibility helps animals to adjust to situations such as migration where they cross over to different time zones. exposure to the light-dark cycle entrains the cycle.
Fruit Fly Courtship: Four necessary steps
- orientation – Male (M) follows and approaches Female (F) tapping her
- Vibration – M extends wing and vibrates it toward her once F is stationary
- Licking – M uses proboscis to lick genitals of F
- Mounting – M gives sperm to female.
Significance: Because each of these steps must take place in order for mating to occur, behavioral geneticists can alter certain genes and observe how it affects this sequence of behaviors. Example 1: Changing eye color of M fly resulted in a disruption of its ability to orient the female properly. Example 2: A mutant yellow body type M fly is unable to vibrate his wings properly during phase 2 – showing that the mutated allele for a yellow body is pleiotropic.
Genes versus Environment: See Nature vs. Nurture.
'Good Genes' Polygyny- System in which females choose among mates based on an honest signal of male quality, rather than for any resources, care or territory the male has to offer.
Gp-9 Gene:Codes for pheromone binding protein involved in recognizing ants. Native South American fire ants have a functional Gp-9 gene and thus can smell outsider queen fire ants and kill them resulting in a slow growing colony. The invasive fire ants in the United States have a defective Gp-9 gene and thus do not recognize alien queens resulting in fast growing colony with 2-200 reproductive queens. This is an example of how single gene effects can produce differences in behavior. (Lecture 10/1).
gynandromorphic finch: A gynandromorph is an organism that contains both male and female characteristics. The term gynandromorph, from Greek "gyn" female and "andro" male. The gynadromorphic finch developed from one egg, but literally half of its body is female, the other is male. The gynadromorphic finch is gonadally split down the middle as well. A gynandromorph is an organism that contains both male and female characteristics. In terms of song control nuclei, the HVc is a lot bigger on “male side” than “female side”. In terms of sex chromosomes, the male sex chromosomes are expressed on the male side, the female sex chromosomes are expressed on female side.
- the finch is an example of a gynandromorph that is lateralized, a gynandromorph can also have a "mosaic" characteristic
Hamilton's equation: rB-C>0 where r is the relatedness between the individual who acts and the individual who benefits from that action, B is the benefit in direct fitness to the recipient and C is the cost in direct fitness to the actor.
Handicap Hypothesis- by Zahavi. an elaborate character (eg peacocks tail) signals good condition or high genetic quality. For such a signal to be honest, it most impose a cost or handicap to the signaler, thus making it reliable.
Haplodiploidy- typically seen in Hymenoptera (bees and ants) where the males are usually haploid individuals derived directly from a diploid female. In honeybees, males are derived directly from the queen (via parthenogenesis) and will therefore share all genes with the queen with an r = 1. When a male drone mates with the queen, only female daughters are derived having shared half of its genes from the father and half from the mother. The daughters can either have an r = .5 or 1 depending on the number of drones the female mates with. On average, the mean relatedness of any two daughters will therefore be .75.
Heritable- more similar between related individuals than between unrelated individuals because of similar genetic makeups of relatives. (Excludes similarity in relatives due to similar environments.)
Heritability- the measure of how much phenotypic variance is due to genetic variance and can thus be passed on from one generation to the next through the genome. If heritability value is = 1, then the offspring are exactly like the parents
Heritability in broad sense- the proportion of total variance in a trait within a population due to genes Vt= Vg+ Ve(+ Vi) H^2(b) = Vg/ Vt It can be calculated through the study of parent-offspring relationships, twin studies, and inbred lines of study.
Heritability in narrow sense-same as above but only additive Vg= Va + Vd + V gi H^2(n) = Va/Vt We learned one specific way to calculate heritability in the narrow sense. First, take a population of individuals with a mean of X1 in the trait that you want to study. Then, select a subset of this original population. The chosen subset should have a mean, X2, for that trait that differs from the original mean (X2X1). After that, mate the individuals in the selected group with each other and measure the mean value of the trait in the population of offspring, X3. Use the three measured means to find the selection and response differentials (selection differential = S = X2-X1; response differential = R = X3-X1). Finally, calculate heritability in the narrow sense by dividing the response by the selection (heritability in the narrow sense = R/S). Note: Remember when doing a question, the heritability is always between a value of 0 - 1, for the class quiz number 11, you should write the heritability is 0.5. (or, 50% is due to additive effect).
Home Range- a space which an individual uses or is familiar with but does not necessarily defend (when a home range is defended, it is referred to as a "territory") -home ranges of animals may overlap, however, a territory, which is in the home range, will not overlap at all; it is costly to maintain large home ranges. while an animal will not defend its entire home range, an animal will defend its individual distance territorially.
Honesty: mating communication in which both sender and receiver benefit and receive an increase in fitness. The two types of honesty are:
- unforced honesty-cooperative signaling where the genetic interests of sender and receiver are aligned.
Example: related ground squirrels send out alarm calls to help kin survive.
- forced honesty-non-cooperative signaling where genetic interests are divergent; sender and receiver are not related.
Example: Gazelles stotting around dog predators to keep dogs from chasing them.
Honest Signaling is reinforced through (1) social costs, (2) maintenance costs, and (3) production costs. Social costs are being able to defend superior status (fight) as exemplified by a badge of status. Example was the alpha females of Common Paperwasps who would increase attacks on beta females, whose faces were experimentally added more black spots. Maintenance costs are the costs that accrue from having an honest signal. The Cock-of-the-Rock bird and the signal intensity exemplified this. The production costs come from the costs of having to produce an honest signal. The plumage in birds, especially if colorful, require intake of carotenoid in the diet, thus, are costly to produce and expensive to build. Because genetic interests are most often not aligned, honest signaling is usually forced.
Honey Bee Ontogeny and Development Female chores vary with age, from nest maintenance to food storage to foraging. Each behavior depends on the amount of Juvenile Hormone the bee has (JH increases with age). Older bees exhibit bigger mushroome bodies with more room for neural structures important for foraging and spatial orientation. Note that neural development still occurs in the absence of JH, indicating anticipatory behavior in female honey bees. examples of plasticity: single cohort colonies adjust JH production to create early foragers as well as keep some females in nursing positions for longer. If you add foragers, they cause other females to not produce as much JH and thus not mature as quickly.
Hormone solastic implants: Behavioral researchers often inserted hormone solastic implants with Testosterone into different animals. In Marler and Moor's study on spiny lizards, the control lizards were not given the additional testosterone, while other lizards were. A a results, the lizards with testosterone implants were extremely aggressive-so much so that the lizards spent so much time defending their territory that they oftened died of starvation. Thus, survival relies on the proper allocation energy reserves to defending territory or gathering resources (food). Moss did a similar study with the red grouse, and had similar results.
Hourglass Model- This theory is one explanation for how photoperiodic time measurement occurs. Say there is some sort of hourglass-like mechanism in the animal that gets flipped at the beginning of the day. In order for a long-photoperiod response to occur, the "sand" in the "hourglass" must run out before darkness falls. If the day is too short (short photoperiod), the "sand" will run out after it is dark and the response won't occur. The problem with this theory is that the hourglass needs to be reset everyday. Experiments have shown that this theory is not accurate for vertebrates, but that there is some evidence of its presence in invertebrates.
Human Biological Clock- Jurgen Aschoff found that whatever physiological variables we measure, we usually find that there is a maximum value at one time of the day and a minimum value at another. humans were observed in an underground bunker and his conclusions were published in Science in 1965 "Circadian Rhythms in Man".
Ideal Free Distribution: Animals will distribute themselves accordingly to the resources available to them. Proposed by Fretwell and Lucas. As more individuals arrive, residents will adjust the size of their territories to fit the newcomer in, thereby decreasing the quality of their territory. There is not a set limit to the size or number of territories.
Illegitimate Receiver:An individual that listens to the signals of others, thereby gaining information that it uses to reduce the fitness of the signaler. Therefore can be said to be the eavesdropper in eavesdropping.(Ex. Tongara Frogs and the bats)
Imprinting: A special form of learning that occurs during the early sensitive phase. It has relatively permanent effects. Discovered by Oskar Heinroth and Konrad Lorenz. Two types of imprinting: 1) filial-individual is imprinted upon by following the parents' behaviors. 2) sexual-mate preference in adulthood influenced by experience in early sensitive phase. In misimprinted individuals, the courtship intensity decreases if not met with reception. An example of sexual imprinting is of zebra finches. They will court another type of finch if they are brought up with the other type of finch family. The strength of imprinting can be modified by later experience.
Innate Releasing Mechanism: The neural network responsible for detecting and processing the simple cue (the sign stimulus or releaser) and activating the instinct (the fixed action pattern). Innate behaviors are common to all members of a species.
Inclusive Fitness: Direct fitness plus indirect fitness. Behaviors should tend to maximize inclusive fitness, rather than just direct or just indirect fitness.
Indirect Fitness: The number of non-descendant relatives produced by an individual, times the degree of relatedness of those relatives to that individual.
Individual distance: The fixed minimal distance an animal attempts to keep between itself and other members of the species.(Wilson, 1975)
Infant Mortality: Studies on evolutionary demography have shown that infant mortality is highest in the first hour of the first day of life. Infant mortality dramatically declines during adolescence and begins to increase steadily towards the end stages of life.
Intraspecific territoriality: refers to territoriality among individuals of the same species
Interneurons: relay neurons that communicate with other neurons; typically functional neurons found in the brain (ex. receive info from sensory (afferent) neurons and send messages to motor (efferent) neurons to create motor output)
Interspecific territoriality: refers to territoriality between different species
Juvenile Hormone (JH): In insects, JH (also neotenin) refers to a group of hormones which ensure growth of the larva, while preventing metamorphosis. Because of their rigid exoskeleton, insects can grow only by periodically shedding their exoskeleton - called molting. This was discovered by Vincent Wigglesworth who showed juvenile hormone at work in kissing bugs by spreading juvenile hormone on parts of the bug's shells. Soon the parts with JH spread on it became a different color from the rest of the shell.
Kin Recognition: The ability to, or act of, classifying some individuals as related to oneself, and others as unrelated to oneself. There are four mechanisms in Kin recognition includes location, familiarity, phenotype matching and recognition alleles. Among the four mechanisms, location and familiarity are context dependent where as phenotype matching and recognition alleles are non context dependent, which means that they can happen anywhere and anytime.
Kin Selection- non-random differential reproductive success arising from heritable variability in traits which affect the direct fitness of an individual's kin, rather than of the individual itself.
Learning: a process that manifests itself by adaptive changes in individual behavior as a result of experience; includes imprinting which occurs during a critical period. Learning is not innate, based on the environment/experience, but also the ability to learn can be genetically coded for like song learning in songbirds. Learning is distinguished from maturing/developing; while learning is based on experience, maturation will happen without experience, and is just a part of the process of aging.
Lek Polygyny- Mating system in which males gather to display for females and females examine the males and mate with those which are most impressive. The males defend a small area of ground for their display but otherwise maintain no territory.
Levels of analysis- The different ways we can attempt to explain the same behavior, including its adaptive value, it phylogeneitc background, the organismal mechanisms underlying it and the developmental and genetic factors leading to it. Explanations on different levels of analysis are generally not mutually exclusive (i.e. if two explanations are on different levels of analysis, they could both be correct).
Life Dinner Principle- Prey will work harder to save its own life than predator will work for a meal, so there is more selection pressure for aggressive behavior in prey than in predators. Predator will not risk injury over a meal, while prey will fight to save own life.
Locusts-
http://caspar.bgsu.edu/~courses/NeuroEthology/Lectures/zlecture27/Lect27_InsectFlight.htm All the images and information on locust movement as an example of central pattern generators is in this link. They have an endogenous rhythm and fictive response pattern.
http://caspar.bgsu.edu/~courses/NeuroEthology/Lectures/zlecture27/Lect27_InsectFlight.htm All the images and information on locust movement as an example of central pattern generators is in this link. They have an endogenous rhythm and fictive response pattern. - 3 pairs of mucles for wings (up, down and twist around). Elevator and depressor muscles and indirect depressor muscles)
- Central Pattern Generator has 100 interneurons.
- Sensors on head can detect wind speed and activate CPG
- 2 main interneurons involved inCPG (electrodes found them) 1)501 2)301
- 206 gets signals about the wind from hairs on head. Exits 204 which activates elevator muscles (E) and Depresor Muscles (D) after a delay to get up and down motion. Fixed delay. 301 exits 501 via 511 (inhibitory circuit). If there is no wind, circuit stops behavior. (See Pictures in the link.)
Lorenz and goose experiments- Imprinting is a natural way that young animals learn social interactions, usually from their parents, including what type of sexual partner is fit or appropriate for them. Konrad Lorenz became the "mother" of a group of greylag geese and so they formed a learned attachment to Lorenz. Therefore, when they reached adulthood, they developed a preference for humans as mates because this experience altered the male goose's nervous system responsible for sexual recognition.
Lunar Rhythms-relatively rare cycles that occur on a longer period than the circadian rhythm. To be a true rhythm, associated behavior must be observed even on cloudy nights. A classic example is the Palolo worm which breeds on a lunar cycle, regardless of cloudiness, by severing its reproductive tail section which floats to the ocean surface and releases eggs and sperm. Another Example is the Banner Tailed Kangaroo Rat who match their foraging behavior to the lunar cycle as they avoid foraging during bright moonlight. However this could just be due to the fact that foraging in bright moonlight makes them more susceptible to predation. (pg 156-157 Alcock)
Mating Strategy- everything an individual does to determine when how and with whom it mates, and to ensure that mating produces offspring.
Mating System- a description of how the species tends to mate, and which males mate with wich females under what circumstances. Female Defense Polygyny, Polyandry and Monogamy are examples of mating systems.
Maturation- as opposed to learning a new behavior, a current behavior is improved over time.
Melatonin-a hormone secreted by the pineal gland which induces sleepiness. Melatonin release is triggered by darkness and production peaks at night. Melatonin release patterns can differ between species depending on lifestyle patterns (e.g. dampened melatonin release in blackcap which migrates nocturnally). Another example of an altered melatonin release system is the Svalpart ptarmigan which lives near the north pole. Melatonin release is dampened in the birds during the winter to allow the bird to forage when conditions are suitable-not solely when it is light outside. Melatonin cannot oscillate on its own in humans.
Midshipman fish - Type 1 males sing to attract females. Governed by a central pattern generator (in the hindbrain), their vocal organ is around the swim bladder and when contracted produces an audible droning song. Type 2 males do not sing (can ‘grunt’ though) and sneak mates with females attracted by type 1 males’ song. In addition, females can only hear this frequency during the mating season (which is approx. 400 kHz); during the winter, they are unable to hear sounds in this frequency (which is about 100 kHz). This is an example of stimulus filtering on a seasonal basis.
Migration-"seasonal or periodic movement of animals in response to changes in climate or food availability, or to ensure reproduction" (msn Encarta). Four mechanisms:
- Piloting, which involves the use of landmarks. (e.g. Gray/Humpback whales use the coastline as a landmark. They keep the coastline on the right side to go north and the coastline on the left to go South).
- Dead Reckoning- animals keep track of all their movements/accelerations/turns. (e.g. Desert ant, uses DR as oppose to pheromone trails)
- Compass- the use of polarization patterns in the sky; the ability to orient with out the use of landmarks. The most common reference in the sun. Monarch butterflies have a simple sun compass (in the morning they fly left of the sun, mid-day towards the sun, and in the afternoon to the right of the sun).
- True Navigation. classic example= Homing pigeon, which is specially trained to return swiftly to its home. Many tests have and are still being made as to the exact means as to how these birds find their way home, however, research indicates that this true navigation is more of a combination of navigation resources (e.g. sensitivity to the earth's magnetic field, to ultraviolet light patterns in the sky, and to polarized sunlight, as well as recognition of landmarks on the earth's surface).
Why do Animals move: (1) Trying to escape unsuitable areas (for instance leaving the snow for a warmer climate during the winter) (2) Find locations more appropriate for certain activities; in particular breeding (many birds migrate to northern Canada every year during a short 6-8 week time interval for the tremendous amounts of insects available as food blooms and the 24/7 period of light allows to fledge a whole nest in a matter of weeks (ie longer time available for mating/reproduction))
Monarch butterfly- an example of a species that makes large migrations over generations. Even though the monarch butterflies' journey goes from Canada to Mexico, the distance is not covered in one single generation. The monarch butterfly mates, reproduces, and its offspring will continue the migration. Alcock discusses in depth the possible explanation of avoiding killing freezes that occur regularly at night in eastern North America during the winters, freezes that are much rarer in high mountain patches of Oyamel fir forest in central Mexico where the monarchs hide-out in large nonfeeding aggregations during the winter. This is an example not only of food NOT being the primary motivator for migration, but also of human resource harvesting impacting the welfare of a species as wood cutting and logging increases the chances that the Monarch butterflies become wet and exposed, and thus more likely to freeze and die.
Monogamy: In biology, one male mating with one female. Monogamy can be social (the pair act as though they only mate with each other) and/or genetic (the pair actually parent all of each other's offspring)
Monozygotic Twins: Identical twins, result of a single egg fertilized by a single sperm that split into two during development. Share 100% of genetic information. Studies by Galton (lec 10/8/07). Differences in monozygotic twins can be explained by DNA methylation aka gene silencing. Mechanism: Certain portions of DNA are bound to and prevented from being expressed; this can result in the formation of different tissues, organs, and behaviors despite an identical genetic code.
Multimodal Signaling: When an individual uses two or more types of signals. Example: the widow bird has a long tail and red shoulder patches. One signal, the long tail, is used for mate attraction, or intrasexual competition; the other is used as a "Badge of Status" in intersexual competition. Multimodal signaling, however, infers a multi-handicap, so it is better to have one high quality sign than two (because of their cost). Example 2: Lyre Bird sings complex songs (mimicking songs of other birds in the forest). It also accompanies its singing with magnificent dance moves, showing off its elaborate feathers.
Myelin: A white, fatty substance in the membrane of Schwann cells which creates the myelin sheath. The sheath is wrapped around the axon of a neuron and helps insulate the nerve and speeds up the transmission of impulses.
Narcolepsy: neurological disorder characterized by recurrent, uncontrollable compulsion to sleep. Symptoms include: 1) Nighttime sleep does not include as much deep sleep, so the brain tries to "catch up" during the day, hence EDS. 2) People with narcolepsy may visibly fall asleep at unpredicted moments (such motions as head bobbing are common). 3) People with narcolepsy fall quickly into what appears to be very deep sleep. 4) They wake up suddenly and can be disoriented when they do (dizziness is a common occurrence). 5) They have very vivid dreams, which they often remember in great detail. 6) People with narcolepsy may dream even when they only fall asleep for a few seconds. This video shown in class shows a narcoleptic dog. (
http://www.youtube.com/watch?v=-zVCYdrw-1o&feature=related)
http://www.youtube.com/watch?v=-zVCYdrw-1o&feature=related)
Narrow Heritability: The proportion of phenotypic variance that can be attributed to additive genetic variance. This estimates that contain all types of genetic variation, the portion of the phenotypic variation that is additive (allelic) by nature (note upper case H2 for broad sense, lower case h2 for narrow sense).
Natural Selection : - Natural selection – differential reproductive success. In a typical environment there are better and worse phenotypes, better ones that are more suited to a particular environment ultimately win out. Natural selection is both predictive and unavoidable if 3 conditions are met by the trait. Those three conditions are that the trait must be heritable, must have variability, and the trait must affect the fitness of the individual.
Nature vs. Nurture: The debate about whether genetics (nature) or environment/experience(nurture) determines behavior is an example of a false dichotomy. Both genetics and environment play a role in almost all behaviors. Professor Bentley discussed how complex behaviors are an interaction between genetics and environment and that depending on the trait, genes can have either a greater or lesser impact on behavior; debate is still ongoing between early ethologists and comparative psychologists (behavioralists) over nature versus nurture controversy and the nativism (perception born with all abilities) and empiricism( perception that abilities are learned and adopted) debate. In class, we discussed the sensory deprivation in chimps in 1940s and kitten experiment in 1960s.
Negative Phonotaxis: (11/20) Phono=sound & taxis=movement. This term refers to the escape behavior in moths. The moths developed an auditory system to escape the bats, so they could detect the echolocation. A weak stimulation of their auditory system was a negative phonotaxis, this meant that the bat was far away, and would result in the bat moving in a straight line away from the sound.
Neuron: A nerve cell; the fundamental unit of the nervous system, having structure (dendtrite, cell body, axon) and properties that allow it to conduct signals by taking advantage of the electrical charge across its cell membrane. Afferent Signal is towards the cell body. Efferent Signal is leaving/ away from the cell body.
Neuroplasticity: The ability of the brain to continue changing and organizing as new experiences are recorded. Also referred to when damage occurs in the brain and it is able to recover and compensate for those damages by moving the activity to another part of the brain. Children have a much greater capacity for plasticity after brain damage than adults.
Nomad: Animal that never frequents the same area. Nomads have a very small individual distance. Animals that travel from area to area in search of resources. (10/23)
Observational Learning: ability of animals to learn by observing the actions of others (Ex. blue tips bird learn to peck through foil caps of milk bottle by recognizing the milk bottle cap), allows new behavior to become established. Another example: Song learning – young birds will hear an adult singing and learn that particular song. Thus success in generation allows it being passed onto next generation. Another example: Caged European Starlings- when one bird learns how to escape from cage, other birds in captivity learn that the pin opens the cage door by observing the bird that has successfully escaped.
Ontogeny: Study of //origin// development and change over an individual's lifetime, //from fertilized egg to its mature form// in particular the beginning and cessation (onset and offset) of specific behaviors. Ex: "play" - the tendency for organisms to exhibit "play" behavior diminishes as organisms age. Another example are the caste of honeybees where female chores depend on age, next maintenance, food storage and foraging.
Operant Conditioning: A process where an animal learns to associate one of its behaviors with a reward or punishment and then tends to repeat or avoid that behavior. Studied by Skinner. Experiments usually use a "skinner box" developed by the researcher while attending Harvard graduate school. Box includes electric floor, red and green lights, food dispensor, response lever, and speaker. Ex. Pigeon Operant Chamber – pigeon learned to peck key to get food.
Parent/Offspring Regression: A method for calculating heritability in which the phenotypes of parents and their offspring are measured, at the same age, and then plotted on separate axes. If there is a strong genetic effect, i.e. an unambiguous slope, then h2 = m.
Pavlov and dog experiments: classical conditioning involved the salivary conditioning of Pavlov's dogs. Pavlov originally found that dogs salivate by smelling and/or seeing food. In Pavlov's classical conditioning experiment, he "conditioned" the dog to salivate not upon seeing food but upon another stimulus. Before each meal, Pavlov would intentionally ring a bell and immediately give his dog food afterwards. After several runs, Pavlov's dog was conditioned to salivate immediately upon hearing the bell as it became a new stimulus (signal) that food will be served. Conditioning can be reversed after several trials, if the bell is rung with no food stimulus afterwards. Then, the dog will no longer salivate upon hearing the bell.
Piloting: One of the four mechanisms of movement/navigation, defined as finding a goal by using landmarks. (Innate) Example given in class on 10/29: Humpback whales keep the coastline on their right hand side to go north when migrating, and the coastline on their left to go south.
Phoresy: “catching a ride”. Is a method of dispersal whereby one organism attaches to another for transportation purposes. (e.g.: Mites and hummingbirds. The mites detect the CO2 exhaled by the birds when they come to the flower to feed. They hop into the bird’s nostrils and “ride” along, hopping off at a different flower. This is important as the mites are too small to ever walk to a different flower themselves. Observations by Colewell at UCB)
Photo-inducible phase: This is the phase in the Resonance cycle that can be stimulated by light pulse If stimulated by light pulse, will show Long Day physiology e.g. gonadal growth Without light pulse stimulation, will show Short Day physiology e.g. no gonadal growth
Photoperiod: the number of hours of light in a 24-hour period.
Photoperiodism- Common in plants, insects, and vertebrates, it's when the annual change in day length triggers a physiological response. The living thing must be able to tell whether day light is increasing or decreasing. There is obvious involvement with the circadian rhythm. EX: Photoperiodism is the reason why Poinsettias turn red as wintertime approaches (decreasing day length). Also in Bentley's lecture on 12/7, he talks about the bird study where you give a light pulse at certain times, which can hit the photosensitive phase tricking it to believe it is a long day and respond appropriately. Rebecca says for example: if the sun normally sets at 5pm, but you induce a light pulse at 7pm, the bird may think it is a long day, and emit a long day response by preparing to breed. (It is called a skeleton photoperiod when only isolated pulses of light are needed to stimulate a response in the animal. A long period of darkness can occur between the pulses of light and the animal still responds as if it was exposed to light for the entire period between the "dawn" pulse and the pulse following it.)
Pineal Gland: synthesizes and secretes melatonin, a horomone that communicates information about environmental lighting to various parts of the body (circadian rhythms). It has the ability to entrain biological rhythms and has important effects on reproductive function of animals. From the SCN, nerve impulses travel via the pineal nerve to the pineal gland. These impulses inhibit the production of melatonin. When these impulses stop (at night, when light no longer stimulates the hypothalamus), pineal inhibition ceases and melatonin is released. The pineal gland is therefore a photosensitive organ and an important timekeeper. Note that an isolated pineal gland in birds will oscillate on its own, and has a memory of the photoperiod it is housed on, but this is not so in mammals, in which the pineal gland relies on SCN input.
Pleiotrophy-When one allele or gene has more than one effect. Rule for genetics rather than the exception- occurs all over the place.
Plural breeding - multiple family units living together. This is a good system to study reproductive conflict. Low skew.
Polyandry- Mating system in which one female mates with multiple males.
Polygamy- mating system in which an individual mates with multiple individuals of the opposite sex. Includes polyandry and polygyny.
Polygyny- mating system in which one male mates with multiple females.
Precocial- Precocial young are born able (or nearly able) to fend for themselves without parental assistance immediately after birth. An example is waterfowl. In contrast to altricial young (those that are born helpless and require lots of parental care; passerine birds are an example)
r- stands for relatedness. Defined as the portion of two individual's genotypes which are identical because of common ancestry.
Raptorial Appendage- modification of a mouth part on a stomatopod. The appendage is either a smasher or a spearer. It differs from that of a praying mantis in that it has a faster strike and it strikes underhand.
Receiver- Receives the signal from sender. They interpret the signal and decide how to respond.
Refractory Period- time after a neuron fires in which it cannot immediately fire again due to hyperpolarization past the resting potential.
Releaser-used for stimuli that have evolved to facilitate communication between animals of same species; a term used to describe simple features of a complex stimulus that brings about a particular fixed action pattern.
Reproductive Strategy- anything and everything an individual does that functions to allow it to reproduce. This includes its production of gametes, how and when and with whom it mates, parental care and so on.
Resource-Holding Power- the inherent capacity of an individual to defeat others when competing for useful resources. (Example: Speckled Wood Butterfly and the spiral fight over territory) An example of an non-arbitrary advantage can be a large body size.
Risen and chimp studies - experiments showed that chimps raised in the dark cannot recognize a milk bottle but can recognize touch, indicating that environment can influence perception; in the Nature/Nurture debate in the 40s when these exepiments were made it indicated that the dichotomy is false dichotomy.
Runaway Selection: A form of sexual selection that occurs when female mating preferences for certain male attributes create a positive feedback loop favoring both males with these attributes and females that prefer them.
Salmon- example from migration lecture 10/29. When spawning, salmon migrate back to the stream where they were born. The migration tactic that salmon use to find their natal stream is their sense of smell. When they are born, the smell of their stream is imprinted on them. This theory was tested in two ways:
- Make some salmon unable to smell and results show that those salmon randomly chose which path to follow unlike others that were able to smell.
- Train the salmon to a particular odor by putting morphalene with hatching eggs. 95% of those salmon returned to the smell when coming back to spawn.
Selection- non-random differential reproductive success arising from heritable variability
Selective attrition- refers to the "Selective attrition and individual song repetoire development in song sparrows" paper we read in discussion; selective attrition refers to a male song sparrow 'losing' songs from the repertoire he learned from a tutor during the 'plastic' phase of song learning. The songs he loses are less similar to his neighbors' songs than the crystallized versions (the ones he keeps). The dual function of this phenomenon is to 1) learn and keep songs similar enough to his neighbors so he will still be recognized as a member of the group and 2) Later "fine tune" the songs so that they are not too similar to his neighbors and that individual recognition (by females, etc.) is still possible. (see Song crystallization)
Selective Pressure- environmental factor(s) that determine adaptive value of different traits
Sender- Maker of a specially evolved signal. Sends signal in order to influence behavior of receiver.
Sensitive Phase- an early time period at which stimuli can be imprinted on. Sensitive periods for imprinting differs for different species. Lorenze claimed that the critical period is driven by an internal developmental schedule, however experiments have shown that there are some social effects that can impact this phase. For example, chicks in groups began following moving objects within 0-3 days, while isolated chicks began following objects after 3 days.
Sensory bias-cortical remapping after brain damage or amputation. Amputees report phantom limb pain when right arm is removed because right brain cells can still be stimulated. The brain can be trained to believe that the phantom limb pain is not present or that the itch is being scratched via a mirror box.
Sexual Dimorphism- the consistant and predictable difference between the sexes in their ornamentation and olther physical characteristics, where males are usually bigger and more ornamented.
Sexual imprinting: mating preference in adulthood that's influenced by experiences in early sensitive phase. Used cross fostering experiments to study this phenomenon. Refer to Lorenz.
Sexual Selection- non-random differential reproductive success arising from heritable variability in traits directly affecting sexual reproduction
Shoot-out experiment- An experiment in which existing territory holders are removed to see who will take their place. Often, new groups take over when old territories are emptied. Everyone goes up in the hierarchy.
Signal - an intentional information transfer in which the sender benefits and should increase fitness on average. A signal can be forced or unforced.
Sign Stimuli and Releasers-features of an animal's environment to which it reacts in a particular way. For example, the fly orchid is a plant that looks like an insect, which helps it attack predators. The term sign stimulus or releaser is used to describe simple features of a complex stimulus that bring about a particular fixed action pattern (ex) red belly of male sticklebacks. Strictly speaking, the term releaser is used for stimuli that have evolved to facilitate communication between animals of the same species.
Significant Differencewhen the outcome/result is supported by mathematical proof that there is difference between A and B. Used to study graphs
Singular breeding-A model of eusociality in which one breeder/breeding pair is surrounded by "helpers," in birds usually male, that aid the breeder/s in raising the young. In this model, the reproductive skew leans towards 1 (high).
Skeleton PhotoperiodsExperiemtnal evidence for the External Coincidence Model. Light dark cycle at which pulses are given at varying time intervals after dawn. The length of time that passes between the first light pulse (at dawn) and the second corresponds in a bell shaped curve to gonadal growth.
Slave oscillators: circadian clocks found in all cells that are controlled/ "whipped into shape" by the suprachiasmatic nucleus (master clock)
Sociality- the tendency to live in groups of conspecifics.
Song Control System (lecture 11/7, also see handout): A neural system unique to birds that consists of two pathways, the motor output pathway and the anterior forebrain pathway. The motor output pathway allows the bird to produce song. The neural signal starts in the HVC to RA to nXIIts to syrinx (the vocal organ). All birds have some form of the motor pathway. The anterior forebrain pathway is unique to some birds; it allows birds to learn songs. A neural signal starts in the HVC to area X to DLM to IMAN to RA then continues with the motor pathway. The learning pathway is most active during the critical and crystallization phase. Both pathways are sensitive to hormonal and seasonal changes.
Song crystallization – a developmental phase in songbirds in which the birds transition from the production of plastic songs (dropping songs that match fewer neighbors) to the performance of a set song pattern. The retained songs are modified to differ from the song of the neighbors so that they are even less similar that the plastic versions were, then used for the rest of the bird’s adult life.
Songs vs. Calls - calls are innate while songs are learned from a tutor and are very complex. The tutors are usually the fathers where learning from the tutors leads to different dialects among the same bird species.
Sperm competition- "competition between sperm of two or more males for the fertilization of an ova" (Parker 1970). An example was shown in the David Attenborough video The Life of Birds, with the two small dunnock birds; females promiscuity induces the initial male to peck her vagina until she ejected the sperm of the second male, after which he mates with her again, ensuring his sperm fertilize her egg.
Spite- Theoretical form of communication in which both the sender and receiver experience a decrease in fitness. The only known examples of this behavior occur in humans only. A possible rational for performing spiteful act would be if the decrease in fitness of the receiver exceeds the decrease in fitness of the sender, thereby benefiting the sender, relatively speaking.
Star Compass- one of the types of compass used by animals as a way of controlled migration, mainly using the North Star (Polaris) as the guide, since the other stars in the sky rotate around that point. This is proven when Emlen exposed new group of birds to a mock sky, where instead of Polaris being the central star, another star or constellation is the center, and the sky rotates around that, then we now see birds using the new constellation as their guide.
Star-nosed Mole- small Insectivore (not a rodent despite superficial similarity) with fleshy appendages on nose. The appendages are covered in extremely sensitive touch receptors, Elmer's organs. One appendage (#11, right above its mouth) is more sensitive than the others. The brain devotes a larger part of its somatosensory cortex to information from appendage #11. Star-nosed moles can detect and eat their prey extremely quickly. In order to maximize efficiency, they consume a lot of small prey with a very short handling time. Their small size means they have a high surface area to volume ratio, so they experience a lot of heat loss and must consume a great deal of food to supply them with enough energy to stay warm..
Stimulus Filtering-means by which certain stimuli are filtered out. Two stages:
- Stage 1: stimuli are filtered out at the level of the receptor. Examples: the primate eye filters out UV info, female midshipman fish are tuned to frequencies of male midshipman fish songs, and parasitoid fly females are tuned to cricket song frequencies.
- Stage 2: stimuli are filtered/categorized by sensory-perceptual system (the brain). Also known as sensory bias. Examples: star-nosed mole
Suprachiasmatic Nucleus- (SCN)- region of the hypothalamus responsible for regulating endogenous circadian rhythms. It acts as the master clock for an organism, and can give survival advantages, such as when to sleep, hide, eat, etc. Called the master clock because it dictates the rhythm of other clocks ("slave oscillators") that require neural or hormonal signals from the SCN to keep cycling. One pathway it uses to synchronize the rhythms of the body is eye>SCN>pineal gland>release of melatonin>synchronize other clocks. Bilaterally located.
Suprachiasmaticnucleexpialidocious- In Central Pattern Generator activity in section, this phrase, when said by GSI was an external stimulus that caused the SCN to reset, thereby entraining the CPG to the "environment."
Supernormal stimuli-artificial stimulus that is more effective than the real thing EX: seagull pecking rate in chicks is higher with just a red stick than with a real bird with a red spot on its beak.
Syrinx: the vocal organ in birds that produces sound; similar to larynx in humans. It is located low down the trachea, where it branches into the two bronchi. There is rapid, independent left and right control such that birds may produce two notes simultaneously (often lower notes from one side, high notes from the other).
Synapse: specialized junctions through which the cells of the nervous system signal to each other and to non-neuronal cells such as those in muscles or glands. Chemical synapses allow the neurons of the central nervous system to form interconnected neural circuits. They are thus crucial to the biological computations that underlie perception and thought. They provide the means through which the nervous system connects to and controls the other systems of the body. A chemical synapse between a motor neuron and a muscle cell is called a neuromuscular junction; this type of synapse is well-understood.
Tau mutant: In 1988, an experiment with Syrian hamsters found that these mutant hamsters operated on longer days (free-running period). If you remove the SCN of a tau mutant and placed it into a normal animal, then that animal will operate on the tau mutant clock. In some cases, the individual can also express both periods - for example, in an incomplete lesion of the SCN of a normal donor into a tau mutant gave results of the individual having cycles that corresponded to both types of cycles.
Testosterone: steroid hormone that crystallizes song learning abilities in song birds. Testosterone has same structure whether you are a song bird or human. Song birds have a sensitive period when they practice and refine their songs. Later on in development, Testosterone stops his ability to learn. During long days when there is photostimulation and GnRH is released, larger gonads and increased testosterone also regulate the song areas to grow and make it more likely for a bird to sing. Note that the hormone does not cause the behavior, it only makes it more likely for that behavior to occur, as many other factors (i.e. environment) are also important determining factors.
Territoriality - The property of maintaining a territory or territories.
When asking if an animal is territorial, think about these 3 questions:
- What are the advantages and benefits of expressing territoriality?
- How does Territoriality affect population or does it regulate population?
- What are the mechanisms used to maintain territoriality?
In order for an animal to be territorial:
- The territory must be defendable (open ocean, open desert, air, etc. are difficult to defend)
- Species must be able to defend the territory (Parker- resource holding potential)
- The territory must be worth defending - fitness benefits must outweigh the costs (ex. mangrove ants: one group can absorb the cost more because they have more numbers in their colony)
The five payoffs of territoriality we discussed in class are:
- Control of resources.
- Anti-parasite function (maintain spacing)
- Anti-predatory function -> spacing discourages formation of search image by predators
- Dear Neighbor Hypothesis (familiarity with neighbors decreases cost of intraspecific competition)
- Home field advantage (familiarity with the geography, resources and pathways of a territory)
Territory- an area occupied more or less exclusively by an animal or group of animals by means of repulsion through overt defense (fighting) or advertisement (Wilson's definition). Functions of a territory include: defense polygyny (or the "male market" in which females come in and incorporate their decision on the quality of the territory), defense system against predators (the more spaced out, the harder it is for them to find prey), and the decrease of the spread of diseases (the more animals are spaced out, the less prone they are to catching a disease).
Tilapia Fish - territory change shape as population becomes more dense, packing is very tight. An extreme example of territorial packing. The fish started out with circular pits, but due the dense population, their pits became hexagonal in shape. This allowed for maximum packing.
Ultimatum Game and Twins: an experimental economic game in which a proposer makes an offer to a responder on how to divide a sum of money. This offer is an ultimatum; if the responder rejects it, both parties receive nothing. Because rejections in the game will give zero payoff to both players, theories of narrow self-interest predict that any positive amount will be accepted by a responder. However, studies show that responders routinely reject free money, presumably in order to punish proposers for offers perceived as unfair. Because identical twins share 100 % of their genes and were subjected to the same environment but fraternal twins share only 50% but were subjected to the same environment, the researchers were able to detect genetic influences by comparing the similarity with which identical and fraternal twins played the game. The results suggest that genetic influences account for as much as 40 percent of the variation in how people respond to unfair offers. In other words, identical twins were more likely to play with the same strategy than fraternal twins.
Unforced Honesty Communication: genetically aligned cooperative, ex. (predator warning signal), intraspecific unforced signal.
Vincent B. Wigglesworth: discovered that the neurosecretory cells in the South American kissing bug secretes a growth hormone which regulates the process of metamorphosis. Also discovered the juvenile hormone whichprevented the development of adult characteristics until the insect had reached the appropriate larval stage.
Waggle dance- a complex form of communication discovered in honeybees that tells other bees at the hive the precise location of flowers with nectar or pollen so they can find the food after leaving the hive. It directs other bees to travel in a specific direction and distance. The duration of the dance is correlated with the distance (the longer the dance, the farther away the food) and the angle of the dance from the verticle axis of the honeycomb is the angle of the food from the sun.
Yarrow's Spiny Lizard- example of territorial aggression. In this species testosterone promotes territorial defense, this increases the activity level of males. So even if they are not actually fighting, they will suffer the same results. An experiment was conducted to increases the testosterone in male lizards this caused them to perform more push up threats displays and expended almost a third more energy than the control lizards. As a result, the hyper territorial males expended their energy reserves and died sooner than males with normal concentrations of testosterone.
Zygosity: The relationship between two twins. Monogygotic (identical) twins are derived from a single fertilized egg that split before developing, and have relatedness of r=1. Dizygotic twins developed from different fertilized eggs and have r=.5, the same as any full sibs.
Subscribe to:
Posts (Atom)